ID: 1010394671

View in Genome Browser
Species Human (GRCh38)
Location 6:75376828-75376850
Sequence AAGTAGTTCAAGAGGCCCAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 127
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 118}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1010394671_1010394675 -3 Left 1010394671 6:75376828-75376850 CCTCTGGGCCTCTTGAACTACTT 0: 1
1: 0
2: 1
3: 7
4: 118
Right 1010394675 6:75376848-75376870 CTTGTTGATGGGATTTAAAGAGG 0: 1
1: 0
2: 0
3: 15
4: 200
1010394671_1010394677 25 Left 1010394671 6:75376828-75376850 CCTCTGGGCCTCTTGAACTACTT 0: 1
1: 0
2: 1
3: 7
4: 118
Right 1010394677 6:75376876-75376898 CCCTCCCTAATTCAAAAATTTGG 0: 1
1: 0
2: 1
3: 18
4: 133

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1010394671 Original CRISPR AAGTAGTTCAAGAGGCCCAG AGG (reversed) Intronic
901589047 1:10323924-10323946 AAGTAATTCAGGAGGCAAAGGGG - Exonic
902389240 1:16093051-16093073 AGGTGGTTAAGGAGGCCCAGAGG + Intergenic
908023183 1:59919756-59919778 AAGGAGTTCATGGGCCCCAGAGG - Intronic
908836266 1:68232117-68232139 AAGTAGCCCAAGAGGCAAAGAGG + Intronic
910207773 1:84764963-84764985 AACTAATTCAAGGGGCCAAGGGG - Intergenic
911294205 1:96094098-96094120 AAGGAGTTCACATGGCCCAGAGG - Intergenic
916194085 1:162207259-162207281 ACGTAGTGCCAGAGGCACAGTGG + Intronic
920319044 1:205103315-205103337 AAATAAATCAAGATGCCCAGTGG + Intronic
1063711459 10:8483005-8483027 CAGCACTTCAGGAGGCCCAGGGG - Intergenic
1063947538 10:11192209-11192231 AAATACTTCAAGAGGCGCAGAGG + Intronic
1066237094 10:33495940-33495962 CAGCACTTTAAGAGGCCCAGGGG - Intergenic
1067356720 10:45535311-45535333 AAGTATTCCAAGAGGCCCCATGG - Exonic
1068357774 10:55932958-55932980 AAGTATTTCAAAAGACCCCGTGG - Intergenic
1069385923 10:67883669-67883691 TAGTAGTTCAAAAGGCTTAGTGG - Intergenic
1069923281 10:71830590-71830612 AAGTAACTGAAGAGGGCCAGTGG - Intronic
1071866690 10:89742294-89742316 TAGTATTTCAAGATCCCCAGTGG - Intronic
1074056695 10:109928681-109928703 AAGCCCTTTAAGAGGCCCAGAGG + Intergenic
1074559065 10:114519109-114519131 AAGTAGTTCAAGAGGCAGCCTGG + Intronic
1080632882 11:34095420-34095442 AAGTAATTCAAGAGGAGCAGTGG + Intronic
1087696310 11:101380231-101380253 AGGTTGTTCAAGAGGCAAAGAGG + Intergenic
1089412748 11:118260549-118260571 AAGTAGTTCAACCCACCCAGTGG - Intronic
1089991429 11:122864876-122864898 AAGTATGTCAAGAAGCCGAGAGG - Intronic
1095514333 12:42989676-42989698 AAGCACGTCAAGGGGCCCAGGGG - Intergenic
1095794746 12:46206082-46206104 AAGTTCTTCAAGAGACACAGAGG + Exonic
1096313149 12:50539726-50539748 AAGTAATAGAAGAGGCCCACGGG - Intronic
1097063239 12:56301179-56301201 AAGTAGGAGAAGTGGCCCAGAGG - Intronic
1098735359 12:74095269-74095291 AAGTAGGTCAAGATGGCCAGAGG + Intergenic
1104164478 12:126214624-126214646 AAGTTGTGAAAGAGGCCAAGGGG - Intergenic
1114627463 14:24138769-24138791 GAGAAGCTCAAGAAGCCCAGGGG + Exonic
1117431910 14:55675085-55675107 AAACAGTTCTAGAGGCCCAAAGG - Intronic
1117476886 14:56104524-56104546 CAGCAGTTCAGGAGGCCAAGGGG + Intergenic
1117545922 14:56794807-56794829 GAGTTGCTCAAGAGGCTCAGAGG - Intergenic
1118392628 14:65308373-65308395 AAGTGGTAGAAGAGACCCAGTGG - Intergenic
1122530163 14:102419618-102419640 AGGCAGGTCAGGAGGCCCAGAGG + Intronic
1122820494 14:104342326-104342348 AAGAATTTCAAGAGGTGCAGTGG + Intergenic
1125514192 15:40308786-40308808 AGGCAGTCCCAGAGGCCCAGAGG - Intergenic
1129750983 15:78063913-78063935 AAGCTGTTGCAGAGGCCCAGGGG - Intronic
1136093077 16:27934621-27934643 GAGAAGTTGAAGAGACCCAGAGG + Intronic
1141108780 16:81255029-81255051 CAGCAGTTTGAGAGGCCCAGAGG - Intronic
1141810924 16:86374984-86375006 AAGGAATTCAGGAGGCCCAAGGG - Intergenic
1142059461 16:88020113-88020135 AAGCAGGTCAAGAGGATCAGAGG + Intronic
1149453879 17:56771659-56771681 AAGTGGTTCAATAGGACTAGAGG + Intergenic
1150099293 17:62407938-62407960 ATAGAGTTTAAGAGGCCCAGAGG + Intronic
1153801406 18:8673879-8673901 AAGTAGTCCAAGAATCCAAGAGG + Intergenic
1156070024 18:33196001-33196023 AAGACATTCCAGAGGCCCAGAGG - Intronic
1160063749 18:75555462-75555484 AACTAGTTCAAGAGGCTCCTTGG + Intergenic
1162321484 19:9973497-9973519 AAGTGGCCCAAGATGCCCAGGGG + Intronic
1162403311 19:10459004-10459026 AAGCTGTTCACGAGCCCCAGGGG - Intronic
1164156047 19:22597922-22597944 GAGGAGTTAAAGAGGCCAAGGGG - Intergenic
925851936 2:8090414-8090436 AAGTAGATGAAGCTGCCCAGGGG - Intergenic
926255156 2:11187464-11187486 ATGTAGTCCAAGACCCCCAGTGG - Intronic
926339323 2:11891891-11891913 AAATAGATCAAGATGCACAGGGG + Intergenic
942174590 2:173320020-173320042 AATTATTTCAAGGGGCCCACTGG - Intergenic
944760553 2:202809399-202809421 CAGTACTTCGAGAGGCCAAGCGG + Intronic
945314975 2:208360988-208361010 AAGTACATCAAGAAGCCCATTGG - Intronic
946733723 2:222733618-222733640 AAACAGGTAAAGAGGCCCAGAGG - Intergenic
948466106 2:238152295-238152317 CAGAAGCTCAAGAGGCTCAGGGG - Exonic
1169677628 20:8172438-8172460 AAACAGTTCAAGAGGCCAATTGG + Intronic
1171339637 20:24417358-24417380 AAATAATTCAAGTGTCCCAGGGG + Intergenic
1174589323 20:51632678-51632700 AACTAGTCCAAAAGCCCCAGAGG + Intronic
1174796220 20:53524836-53524858 TAGTTGTCCAAGAGACCCAGTGG + Intergenic
950351771 3:12361802-12361824 AGGAAATTCAAGAGGCCAAGTGG - Intronic
954814898 3:53272787-53272809 CAGTACTTCAGGAGGCCGAGAGG - Intergenic
957880569 3:86206733-86206755 TAGAAGTTCAAGTGGCCTAGTGG - Intergenic
957884970 3:86275152-86275174 AAGTAGAATAAGAGGCCCAAAGG + Intergenic
958036611 3:88176694-88176716 AGGTAGTTCAGGAGGCTGAGAGG + Intergenic
958659795 3:97051914-97051936 AAGTAGTTCAATATGGCTAGCGG - Intronic
958865900 3:99501364-99501386 GAGTATTTCAAGATGCCCAGGGG + Intergenic
960300096 3:115992284-115992306 CAGTAGTTGATGAGGGCCAGAGG + Intronic
961405793 3:126678872-126678894 AAGTTGTTCAAGAACCCCAGAGG - Intergenic
964199429 3:154101423-154101445 AAGTAGTCCAATACACCCAGAGG + Intergenic
965684632 3:171289080-171289102 AAGCAGTTCAAGAGGCATAAGGG + Intronic
968962082 4:3750748-3750770 AAGCAGGACATGAGGCCCAGAGG - Intergenic
969201977 4:5613688-5613710 AGGTAGTTTAGGAAGCCCAGTGG + Intronic
969615097 4:8247532-8247554 AGGGACTCCAAGAGGCCCAGGGG + Intergenic
973004559 4:44991449-44991471 AAGTACCTCCAGAGGCTCAGTGG + Intergenic
976673084 4:87675084-87675106 ATGTTGTTCAAGGGACCCAGTGG - Intergenic
978564200 4:110064613-110064635 AAATAGTTAAATAGGCACAGTGG - Intronic
987960111 5:24796330-24796352 AAATATTTCAAGATACCCAGTGG - Intergenic
989853829 5:46252830-46252852 AAGTAGCTCAAGAACCCCTGTGG - Intergenic
992794451 5:80243136-80243158 CATAAGTTCAAGAGTCCCAGGGG + Intronic
993999497 5:94761881-94761903 AAGTATTTCAAGAGACCCAGTGG - Intronic
996563523 5:124856116-124856138 AAGAAGTCCTAGAGGCCCGGTGG - Intergenic
999366448 5:151026798-151026820 CAGTAGTTCCAGCGGCACAGCGG + Intronic
999935452 5:156481244-156481266 AAGTAGATAAAAAGGCCCTGGGG + Intronic
1002340036 5:178509778-178509800 CAGTTGTTTAAGGGGCCCAGAGG - Intronic
1004338859 6:14789336-14789358 AAGTGGTTCAAGCTTCCCAGTGG + Intergenic
1008128949 6:47698762-47698784 AAGTAGATCTAGCAGCCCAGAGG - Exonic
1008379129 6:50822989-50823011 AAGTAGTTAAAAACACCCAGAGG + Intronic
1009488088 6:64250968-64250990 AAGTAGATCAAAAGGCTCTGAGG + Intronic
1010394671 6:75376828-75376850 AAGTAGTTCAAGAGGCCCAGAGG - Intronic
1012724188 6:102787115-102787137 AAGTTGTTGGAGAGACCCAGTGG - Intergenic
1013560503 6:111299308-111299330 AAGTATTGCAACAGGCCCACAGG + Exonic
1014074796 6:117223684-117223706 TAGTAGTTAAAGAGGCCAACAGG - Intergenic
1016226452 6:141745079-141745101 AAGTGTTCCAAGAGGCGCAGTGG - Intergenic
1016991688 6:149934364-149934386 AAATATTTCAATAAGCCCAGAGG + Intergenic
1017004083 6:150017057-150017079 AAATATTTCAATAAGCCCAGAGG - Intergenic
1017008051 6:150042191-150042213 CACTATTTCAATAGGCCCAGAGG - Intergenic
1018042093 6:159933813-159933835 AAGTAGGTTTAGAGGGCCAGGGG + Intergenic
1019385419 7:753011-753033 AAGCAGTCCGAGAGGCACAGTGG - Intronic
1021841264 7:24723518-24723540 AAGCATTTAAAGAGGCCCATGGG + Intronic
1022462104 7:30619306-30619328 AAGAAGCTCCAGAGTCCCAGAGG + Intronic
1024303721 7:47908530-47908552 ACGTAATTCACAAGGCCCAGTGG - Intronic
1026078494 7:67195542-67195564 AAGTACTTCAAGATGTCCAGAGG - Intronic
1026127398 7:67591444-67591466 CAGCAGTTCAGGAGGCCGAGGGG + Intergenic
1026698330 7:72616445-72616467 AAGTACTTCAAGGTGTCCAGAGG + Intronic
1027441041 7:78219503-78219525 CAGTAGTACGAGAGGCCCTGAGG - Intronic
1031540782 7:122992218-122992240 CAGCACTTCAGGAGGCCCAGGGG - Intergenic
1033195331 7:139322516-139322538 AAGTGGGCCAAGAGGGCCAGGGG - Intergenic
1033249308 7:139745308-139745330 AAGTAGTTCAAAAGCTCCAAGGG - Intronic
1033868783 7:145723990-145724012 ATGTTGTTCCAGAGGCTCAGTGG - Intergenic
1035587356 8:786217-786239 CAGTAGCTCATGGGGCCCAGTGG + Intergenic
1042318714 8:67452259-67452281 AATGACTTCAAGAGGGCCAGAGG + Intronic
1045008149 8:97933845-97933867 AAGTTGATAAAGAGGCCCTGGGG - Intronic
1045022739 8:98058596-98058618 TTGTAGTTCAACAGGCACAGTGG + Intergenic
1045031672 8:98142897-98142919 AAACAGTTCAAAGGGCCCAGGGG - Intronic
1048180358 8:132188936-132188958 ATGTTGTTCATGAGGCCTAGGGG - Intronic
1048212070 8:132463260-132463282 GCGTAGTTCAAGAGCACCAGAGG + Intronic
1050312477 9:4367450-4367472 AGGAAATTCAGGAGGCCCAGGGG - Intergenic
1055855340 9:80679342-80679364 CAGAACTTCAAGATGCCCAGTGG + Intergenic
1058404051 9:104651693-104651715 AAGTATTTCAGGAGGACAAGAGG - Intergenic
1061809619 9:133154799-133154821 AAGGAGTCCCAGAGGCCCAGAGG + Intronic
1186858194 X:13645970-13645992 AGGAAGTTCAACGGGCCCAGGGG + Intergenic
1189404135 X:40703270-40703292 AAGTAGTTAAAACGGCCCCGAGG + Intronic
1196526311 X:116731288-116731310 AGATGGTTCAAGAGGCTCAGAGG - Intergenic
1199023820 X:142913761-142913783 CAGCAGTTCAGGAGGCCAAGAGG - Intergenic
1199361646 X:146926904-146926926 AGGTAATGCAAGAGGCCCACGGG - Intergenic