ID: 1010406980

View in Genome Browser
Species Human (GRCh38)
Location 6:75516782-75516804
Sequence ATGGTAACTTGGTGGACCAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1010406973_1010406980 6 Left 1010406973 6:75516753-75516775 CCCAGTTTATAATGGGTAGCTCA No data
Right 1010406980 6:75516782-75516804 ATGGTAACTTGGTGGACCAAGGG No data
1010406974_1010406980 5 Left 1010406974 6:75516754-75516776 CCAGTTTATAATGGGTAGCTCAG No data
Right 1010406980 6:75516782-75516804 ATGGTAACTTGGTGGACCAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1010406980 Original CRISPR ATGGTAACTTGGTGGACCAA GGG Intergenic
No off target data available for this crispr