ID: 1010407282

View in Genome Browser
Species Human (GRCh38)
Location 6:75519666-75519688
Sequence CAATTCCCACAGATTTTCCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1010407277_1010407282 26 Left 1010407277 6:75519617-75519639 CCTGATCCAACTTTATGTTTTTT No data
Right 1010407282 6:75519666-75519688 CAATTCCCACAGATTTTCCCTGG No data
1010407280_1010407282 0 Left 1010407280 6:75519643-75519665 CCATTATTTCACACCTTTAATAT No data
Right 1010407282 6:75519666-75519688 CAATTCCCACAGATTTTCCCTGG No data
1010407279_1010407282 3 Left 1010407279 6:75519640-75519662 CCACCATTATTTCACACCTTTAA No data
Right 1010407282 6:75519666-75519688 CAATTCCCACAGATTTTCCCTGG No data
1010407278_1010407282 20 Left 1010407278 6:75519623-75519645 CCAACTTTATGTTTTTTCCACCA No data
Right 1010407282 6:75519666-75519688 CAATTCCCACAGATTTTCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1010407282 Original CRISPR CAATTCCCACAGATTTTCCC TGG Intergenic
No off target data available for this crispr