ID: 1010407362

View in Genome Browser
Species Human (GRCh38)
Location 6:75520268-75520290
Sequence CCTTATTTCCTGTAGCTGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1010407362_1010407366 -10 Left 1010407362 6:75520268-75520290 CCCTGCAGCTACAGGAAATAAGG No data
Right 1010407366 6:75520281-75520303 GGAAATAAGGCTCTCTTTCAGGG No data
1010407362_1010407367 7 Left 1010407362 6:75520268-75520290 CCCTGCAGCTACAGGAAATAAGG No data
Right 1010407367 6:75520298-75520320 TCAGGGCATACTTAGCTTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1010407362 Original CRISPR CCTTATTTCCTGTAGCTGCA GGG (reversed) Intergenic
No off target data available for this crispr