ID: 1010409287

View in Genome Browser
Species Human (GRCh38)
Location 6:75542837-75542859
Sequence AGCTACTCGGGACGGCAAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1010409279_1010409287 7 Left 1010409279 6:75542807-75542829 CCGAGTATGGTGATGGGAACCTG No data
Right 1010409287 6:75542837-75542859 AGCTACTCGGGACGGCAAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1010409287 Original CRISPR AGCTACTCGGGACGGCAAGG AGG Intergenic
No off target data available for this crispr