ID: 1010410373

View in Genome Browser
Species Human (GRCh38)
Location 6:75554691-75554713
Sequence ATATTTACAAAGGTGTGGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1010410373_1010410382 29 Left 1010410373 6:75554691-75554713 CCCAGCCACACCTTTGTAAATAT No data
Right 1010410382 6:75554743-75554765 ATCCACAATTCAACCAAACATGG No data
1010410373_1010410377 -2 Left 1010410373 6:75554691-75554713 CCCAGCCACACCTTTGTAAATAT No data
Right 1010410377 6:75554712-75554734 ATAGTCAGCCCTCCATATCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1010410373 Original CRISPR ATATTTACAAAGGTGTGGCT GGG (reversed) Intergenic
No off target data available for this crispr