ID: 1010413657

View in Genome Browser
Species Human (GRCh38)
Location 6:75589202-75589224
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1010413655_1010413657 -3 Left 1010413655 6:75589182-75589204 CCACAAAAATTGTAGAGTTAACA No data
Right 1010413657 6:75589202-75589224 ACATATACAAAGTTTAGAAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1010413657 Original CRISPR ACATATACAAAGTTTAGAAA GGG Intergenic
No off target data available for this crispr