ID: 1010415127

View in Genome Browser
Species Human (GRCh38)
Location 6:75602832-75602854
Sequence ACTTCAGCGCGCACTCTCAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 40
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 37}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1010415127_1010415132 8 Left 1010415127 6:75602832-75602854 CCTTTGAGAGTGCGCGCTGAAGT 0: 1
1: 0
2: 0
3: 2
4: 37
Right 1010415132 6:75602863-75602885 TTTAAAAAATTTTGGGGTGGTGG 0: 1
1: 2
2: 6
3: 82
4: 804
1010415127_1010415129 1 Left 1010415127 6:75602832-75602854 CCTTTGAGAGTGCGCGCTGAAGT 0: 1
1: 0
2: 0
3: 2
4: 37
Right 1010415129 6:75602856-75602878 TTTGACATTTAAAAAATTTTGGG 0: 1
1: 0
2: 13
3: 186
4: 1485
1010415127_1010415131 5 Left 1010415127 6:75602832-75602854 CCTTTGAGAGTGCGCGCTGAAGT 0: 1
1: 0
2: 0
3: 2
4: 37
Right 1010415131 6:75602860-75602882 ACATTTAAAAAATTTTGGGGTGG No data
1010415127_1010415130 2 Left 1010415127 6:75602832-75602854 CCTTTGAGAGTGCGCGCTGAAGT 0: 1
1: 0
2: 0
3: 2
4: 37
Right 1010415130 6:75602857-75602879 TTGACATTTAAAAAATTTTGGGG 0: 1
1: 0
2: 12
3: 94
4: 1065
1010415127_1010415133 15 Left 1010415127 6:75602832-75602854 CCTTTGAGAGTGCGCGCTGAAGT 0: 1
1: 0
2: 0
3: 2
4: 37
Right 1010415133 6:75602870-75602892 AATTTTGGGGTGGTGGCCTAAGG No data
1010415127_1010415128 0 Left 1010415127 6:75602832-75602854 CCTTTGAGAGTGCGCGCTGAAGT 0: 1
1: 0
2: 0
3: 2
4: 37
Right 1010415128 6:75602855-75602877 CTTTGACATTTAAAAAATTTTGG 0: 1
1: 0
2: 8
3: 109
4: 802

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1010415127 Original CRISPR ACTTCAGCGCGCACTCTCAA AGG (reversed) Intronic
902401493 1:16160078-16160100 GATCCAGCGCGCACTCTCATGGG + Intergenic
903177163 1:21588029-21588051 ACTTCAGCCCCCAGTCCCAACGG + Intergenic
1062823509 10:551740-551762 AATTCAGCCAGCTCTCTCAATGG + Intronic
1076321139 10:129582295-129582317 ACAACAGAGCACACTCTCAACGG - Intronic
1081890948 11:46542181-46542203 ACTTGATGGCACACTCTCAAAGG + Exonic
1092003860 12:5052473-5052495 ACGTCAGCGCTAACTGTCAAAGG + Intergenic
1095678323 12:44945734-44945756 ACTTCAGCCCACACTCTCTTAGG + Intergenic
1105205448 13:18219529-18219551 ACTTCAGGGAGCACATTCAATGG + Intergenic
1123797316 15:23784683-23784705 ACTTCAGCTCACATTCTCAAAGG + Intergenic
1131025706 15:89139762-89139784 ACTTGAGTGCACACACTCAAGGG - Intronic
1155517279 18:26636533-26636555 AATTCAGAGAGCACTCTCAATGG - Intronic
925969394 2:9096199-9096221 ACTTCAGAGGTCACTCTCTAGGG - Intergenic
929741475 2:44605775-44605797 CCCTCAGCACTCACTCTCAAAGG - Intronic
948633977 2:239322304-239322326 ACTTCAGAGCGCAAGCTCACTGG + Intronic
1180668645 22:17535362-17535384 ACTTCATCAGGCACTGTCAAAGG - Intronic
1180760526 22:18199189-18199211 ACTTCAGGGAGCACATTCAATGG - Intergenic
1180770839 22:18383486-18383508 ACTTCAGGGAGCACATTCAATGG - Intergenic
1180775143 22:18425507-18425529 ACTTCAGGGAGCACATTCAATGG + Intergenic
1180808218 22:18736562-18736584 ACTTCAGGGAGCACATTCAATGG + Intergenic
1181071142 22:20341527-20341549 ACTTCAGGGAGCACATTCAATGG + Intergenic
1181194213 22:21170476-21170498 ACTTCAGGGAGCACATTCAATGG + Intergenic
1181215228 22:21322302-21322324 ACTTCAGGGAGCACATTCAATGG - Intergenic
1203232673 22_KI270731v1_random:124658-124680 ACTTCAGGGAGCACATTCAATGG - Intergenic
953169921 3:40497768-40497790 ATTTCAGCCCACACTCTCACAGG + Intergenic
955593428 3:60562364-60562386 ACTCCATCACTCACTCTCAATGG - Intronic
976602972 4:86955739-86955761 ACTTCAGTACCCACTCTGAATGG - Intronic
984421011 4:179521380-179521402 ACTTCAGCGTGCTCTGTTAATGG + Intergenic
998432601 5:142079235-142079257 ACTTCAGCTCGGCCTCCCAAGGG - Intergenic
1004413159 6:15400441-15400463 ACTCCAGGGCGCAGTTTCAATGG - Intronic
1007430762 6:41775432-41775454 ACATCGGCGGCCACTCTCAAAGG + Exonic
1010415127 6:75602832-75602854 ACTTCAGCGCGCACTCTCAAAGG - Intronic
1010519285 6:76812607-76812629 TCTCCAGCACTCACTCTCAAAGG + Intergenic
1020737190 7:11965482-11965504 ACTACAGCACTCACTCTTAAAGG + Intergenic
1034089817 7:148353197-148353219 ACTTCAGTGGGCATTCTCAGAGG - Intronic
1041059328 8:54021418-54021440 ACTACAGCACGCACACTCACCGG - Intronic
1042395990 8:68292644-68292666 TCTGCAGCCGGCACTCTCAATGG + Intergenic
1042433421 8:68735227-68735249 ACTTCAGGGAGCAGTTTCAATGG + Intronic
1062375691 9:136260852-136260874 GCTGCAGCCCGCACTCTCACTGG + Intergenic
1189593763 X:42542994-42543016 ACTTCAGCGCACAGTGGCAAGGG - Intergenic
1191095621 X:56670481-56670503 ACTTTGGCGAGCACTCACAAGGG + Intergenic