ID: 1010415592

View in Genome Browser
Species Human (GRCh38)
Location 6:75607885-75607907
Sequence CTAGTTCAACAGACAGTGTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 116
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 104}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1010415592_1010415595 12 Left 1010415592 6:75607885-75607907 CCTAACACTGTCTGTTGAACTAG 0: 1
1: 0
2: 1
3: 10
4: 104
Right 1010415595 6:75607920-75607942 CCCAAACGATTGGCATTCCATGG No data
1010415592_1010415598 25 Left 1010415592 6:75607885-75607907 CCTAACACTGTCTGTTGAACTAG 0: 1
1: 0
2: 1
3: 10
4: 104
Right 1010415598 6:75607933-75607955 CATTCCATGGAATATGAACAGGG 0: 1
1: 0
2: 0
3: 23
4: 144
1010415592_1010415597 24 Left 1010415592 6:75607885-75607907 CCTAACACTGTCTGTTGAACTAG 0: 1
1: 0
2: 1
3: 10
4: 104
Right 1010415597 6:75607932-75607954 GCATTCCATGGAATATGAACAGG 0: 1
1: 0
2: 1
3: 8
4: 128
1010415592_1010415593 2 Left 1010415592 6:75607885-75607907 CCTAACACTGTCTGTTGAACTAG 0: 1
1: 0
2: 1
3: 10
4: 104
Right 1010415593 6:75607910-75607932 CACAGCTTCTCCCAAACGATTGG 0: 1
1: 0
2: 0
3: 13
4: 71

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1010415592 Original CRISPR CTAGTTCAACAGACAGTGTT AGG (reversed) Intronic
903235571 1:21948628-21948650 CTAGTTCAAGAGACAGTTCAAGG - Intergenic
904029818 1:27527297-27527319 CTAGGTCAACAGACAGCTGTGGG + Intergenic
908329019 1:63052170-63052192 TTAGTTTAGCCGACAGTGTTTGG - Intergenic
911249104 1:95554887-95554909 CTTGTTCAACAGAGGGTGATAGG - Intergenic
912868600 1:113282341-113282363 CTAGTTAAAAACACAGTATTGGG + Intergenic
915336154 1:155143338-155143360 CTAGTTCAACAAATATTTTTCGG - Intergenic
919541566 1:198853039-198853061 CTACTTCAACAAATGGTGTTGGG + Intergenic
924029669 1:239873625-239873647 GTTTTTCAACAGACAGTGATAGG - Intronic
1062847066 10:715854-715876 TTTTTTCAACAGACAGTGTTGGG - Intergenic
1063486838 10:6428137-6428159 CTGGTTCAAGAGACACTGCTTGG - Exonic
1063897677 10:10699575-10699597 CTAGGTAGACAGACAGTGTGGGG + Intergenic
1066150890 10:32615903-32615925 CTAATTCAATAAACAGTGTTGGG - Intronic
1067767805 10:49100934-49100956 CCTCTTCAACAGACAGTGTAGGG + Intronic
1072431320 10:95373797-95373819 CTAGTTGAACTAACAGGGTTTGG - Intronic
1073172260 10:101520436-101520458 CTAGTACCAAGGACAGTGTTTGG + Intronic
1079460602 11:20674779-20674801 CTAGTTCTACAGAGTTTGTTTGG + Intronic
1081178830 11:39962483-39962505 CTAGTTCAAAAGACAATGCCAGG - Intergenic
1081326301 11:41749410-41749432 TTATTTCAACAAACAGTGCTAGG - Intergenic
1084158592 11:67331056-67331078 CTATTTCAATAGTCAGTGTAAGG + Intronic
1087882566 11:103435221-103435243 CTATGTAATCAGACAGTGTTTGG + Intronic
1088423744 11:109677458-109677480 CCAATTCCACAGACAGTGTCTGG + Intergenic
1088560367 11:111109168-111109190 ATAGATCAAAAGACAGTGTTAGG + Intergenic
1088741799 11:112773621-112773643 CAGGTTCAAGAGACAGTGGTGGG + Intergenic
1090222713 11:125043850-125043872 CTTTTTCAACAAACAGTGTTGGG - Intergenic
1093660998 12:21756707-21756729 CTATTTCAACAGGCAGAGATGGG - Intronic
1096742292 12:53702604-53702626 CTACCTCCACAGACAGTGTCTGG - Intergenic
1101570648 12:105950598-105950620 ATAGTTCAGGAGACAATGTTCGG - Intergenic
1104335358 12:127889392-127889414 TTAGTACATCAGACAGGGTTGGG - Intergenic
1107795806 13:44050373-44050395 TCAGTTCAACACACAGTGTAAGG - Intergenic
1111358082 13:87137330-87137352 CTTGTTAAACAGACATTCTTTGG + Intergenic
1113555704 13:111232270-111232292 TTAGTTCTGCAGACAGTGTATGG - Intronic
1116871018 14:50069299-50069321 CTAGTTTTACAGCCAGAGTTTGG - Intergenic
1127827838 15:62720507-62720529 CTAGTTCAACTGATAGTTGTAGG + Intronic
1128874518 15:71191269-71191291 GAAGTTCTACAGACACTGTTGGG - Intronic
1131350577 15:91695922-91695944 ATGGTTTAACACACAGTGTTTGG + Intergenic
1139059370 16:63230404-63230426 CTAGTTCAACAGTCAGGGGAGGG - Intergenic
1139067604 16:63337417-63337439 CATGTCCAACTGACAGTGTTTGG + Intergenic
1150342894 17:64383205-64383227 CTAGACCAGCAGACAGTGCTGGG + Intronic
1150550113 17:66202529-66202551 CTTCTTCAACAGACAGAGCTAGG - Intergenic
1203161626 17_GL000205v2_random:57366-57388 CTAAGTCAAGAGACAGTGATTGG - Intergenic
1153224255 18:2885939-2885961 CTATTTTTACAGACAATGTTGGG - Intronic
1154072510 18:11165409-11165431 CTATTTCAACAGAGAGTGTACGG + Intergenic
1155646600 18:28085779-28085801 CTAGTGCAAAACACTGTGTTTGG + Intronic
1157728972 18:49987543-49987565 CTAGTTCAACAGGCAGAGATTGG + Intronic
1159858669 18:73619330-73619352 ATAGTTCCACATAAAGTGTTAGG + Intergenic
1164384204 19:27759599-27759621 ATAATTAAACAGCCAGTGTTCGG + Intergenic
926231395 2:11006700-11006722 ATCGTGCAACAGGCAGTGTTAGG - Intergenic
926756310 2:16238950-16238972 CTAGTTCTAGAGACAGGGGTGGG - Intergenic
927403164 2:22737409-22737431 TCTCTTCAACAGACAGTGTTGGG + Intergenic
932360331 2:71100079-71100101 CTAGCTCAAAAGACAGATTTGGG + Intergenic
932712492 2:74077648-74077670 CTAGCTGATCAGACAGTGCTTGG + Intronic
933623313 2:84569970-84569992 CTATTTCAACAGACAGGTCTAGG - Intronic
934122376 2:88852915-88852937 CTTGTCCCACAGACAGTGTGAGG + Intergenic
938247977 2:129793653-129793675 TTACCTCAACAGCCAGTGTTGGG - Intergenic
947101193 2:226622826-226622848 ATAGTTCAACATGCAGTGATTGG - Intergenic
1169492211 20:6080871-6080893 CCAGTTCAAGAGACAGTTCTGGG + Intronic
1178250828 21:31001733-31001755 CTAGATCAGGAGACAGTCTTGGG - Intergenic
1181687221 22:24537804-24537826 CAAATTCAACTGACAGGGTTTGG - Intergenic
1182979340 22:34653821-34653843 ATAATTCAACAAACAGGGTTAGG + Intergenic
1183599553 22:38832067-38832089 CTATTTAAACAGACGCTGTTTGG + Intronic
949691736 3:6648349-6648371 ATAGTTAAACAGGCAGTCTTAGG - Intergenic
950091343 3:10297299-10297321 ATAGGACAACAGGCAGTGTTTGG - Intronic
950318388 3:12026087-12026109 CTAATTCATAAGAGAGTGTTGGG + Intronic
954512747 3:51141553-51141575 GTATTTCAACAAACAGTGTTGGG - Intronic
955751887 3:62191757-62191779 CATGTTCACCAGACAGTGTGAGG - Intronic
959693161 3:109221020-109221042 CTAGTTTAAAAAAAAGTGTTTGG + Intergenic
961053750 3:123768800-123768822 CCTGTTCACCAGACAGTGTATGG - Intronic
963723125 3:148886923-148886945 CTAGTTCACCATACAGATTTCGG - Intronic
965097362 3:164249544-164249566 GTAGTTCAGCAGGCAGTCTTAGG - Intergenic
965748541 3:171951699-171951721 CTGGCTCAACATACAGTTTTTGG + Intergenic
967401065 3:189061204-189061226 CTTGTTCAATAAACGGTGTTTGG + Intronic
969910464 4:10440180-10440202 CTAGTTCAACAGACAGCAGGTGG + Exonic
970814679 4:20140341-20140363 TGAGTTGAAAAGACAGTGTTAGG + Intergenic
971149567 4:24017317-24017339 CTAATTTCACATACAGTGTTAGG - Intergenic
973136577 4:46715667-46715689 CGAGTTCAACAGACAGTAGGGGG - Intergenic
974085687 4:57258431-57258453 CCTGTTCAATAAACAGTGTTGGG - Intergenic
976798572 4:88961775-88961797 CTAACTCAACAGAAAGTTTTGGG + Intronic
981059115 4:140401072-140401094 CTAGTTTAAGAGGCAGTGGTAGG - Intronic
982011620 4:151111261-151111283 CAAATTCAACTGACAGGGTTTGG + Intronic
986642758 5:9888471-9888493 ATAGTTCAGCAGGCTGTGTTGGG - Intergenic
986909742 5:12540605-12540627 CAGGTACAACATACAGTGTTTGG + Intergenic
991487229 5:67150091-67150113 ATAGCTCAACTGACAGGGTTGGG - Intronic
997681081 5:135751116-135751138 CTAGTTCACCAGCCAGTGCACGG - Intergenic
998296458 5:140974359-140974381 CCAGTACAACAGAAAGTGCTAGG - Intronic
1001097702 5:168788623-168788645 CTAGTACCACAAACTGTGTTTGG - Intronic
1001194246 5:169657041-169657063 TTATTTGAAAAGACAGTGTTTGG + Intronic
1007648626 6:43402044-43402066 CTACTCCAAAAGATAGTGTTTGG - Intergenic
1008627050 6:53326966-53326988 CTAGTGCAGCAGACAGTTATGGG + Intronic
1010389896 6:75324846-75324868 CCTGTTCAACAGACGGTGCTGGG + Intronic
1010415592 6:75607885-75607907 CTAGTTCAACAGACAGTGTTAGG - Intronic
1011287653 6:85742347-85742369 CTATTTCAACAAACAGTGTTGGG - Intergenic
1011565952 6:88671870-88671892 CTAATTCAACAAACAGTGCTGGG + Intronic
1012080678 6:94754921-94754943 TTTGTTCAAAACACAGTGTTGGG - Intergenic
1012142941 6:95646060-95646082 CTTTTTCAAAATACAGTGTTTGG - Intergenic
1017933725 6:158985075-158985097 CTTGGTCATCAGACAGTGCTTGG - Intronic
1018098742 6:160417498-160417520 CTAGTTCAACTGCCAGAGTAGGG + Intronic
1023388108 7:39680740-39680762 ATAATTCAACAGGTAGTGTTTGG - Intronic
1030242853 7:107348319-107348341 CTAGTTTCACAGAAAGAGTTGGG + Intronic
1034310146 7:150080138-150080160 GTAGTTCAAGAGTCAGAGTTGGG - Intergenic
1034796699 7:154020482-154020504 GTAGTTCAAGAGTCAGAGTTGGG + Intronic
1035528702 8:334834-334856 CTCATGCAACAGCCAGTGTTTGG + Intergenic
1036492780 8:9243334-9243356 CTATCACAACAGACAGTGTGGGG - Intergenic
1038517258 8:28197558-28197580 CTAGTTGAACAGACTGAGCTGGG - Intergenic
1042064470 8:64858743-64858765 TTCTTTCAACAGATAGTGTTGGG + Intergenic
1045711301 8:104987735-104987757 TTAGTTCTAAAGACAGTGTTGGG + Intronic
1046049570 8:109006650-109006672 ATAGTTAAACAGACACTTTTAGG - Intergenic
1051595518 9:18821150-18821172 ATAGTTCAAGAGTCAGTGATGGG + Intronic
1052186132 9:25596520-25596542 TTTCTTCAACAGATAGTGTTGGG - Intergenic
1053844071 9:42218380-42218402 CTAGTTCAACAGTCAAAGATCGG - Intergenic
1055310899 9:74978507-74978529 TTAATTCAACTGACAGGGTTTGG + Intergenic
1188584494 X:31756793-31756815 TTATTTAAACATACAGTGTTTGG - Intronic
1189535286 X:41928630-41928652 CTTATTCAACAGCCAGTGTTAGG - Intergenic
1191722373 X:64243932-64243954 CCTGTTCAACAAACAGTGCTAGG - Intergenic
1194021647 X:88698685-88698707 CTAGTGAAACAGAAAGTGTGGGG + Intergenic
1196244447 X:113383466-113383488 TTAGTTTAGAAGACAGTGTTTGG + Intergenic
1201688709 Y:16737379-16737401 CTGGTGATACAGACAGTGTTGGG - Intergenic