ID: 1010420548

View in Genome Browser
Species Human (GRCh38)
Location 6:75669787-75669809
Sequence TAAAATGCTGCTAGTTATAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 264
Summary {0: 1, 1: 0, 2: 1, 3: 25, 4: 237}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1010420548 Original CRISPR TAAAATGCTGCTAGTTATAG TGG (reversed) Intronic
905768469 1:40622463-40622485 TAAAATGCTGCTTCTTCTACTGG - Exonic
906995845 1:50793372-50793394 TAAAATGATGCTAATTACTGGGG + Intronic
908198980 1:61774396-61774418 TAGAAACCTGCTAGTTAGAGGGG + Intronic
908646451 1:66283295-66283317 TAAAATAGTGCCAATTATAGAGG + Intronic
909104434 1:71391347-71391369 CAAAATGCTGATAGTGATACAGG + Intergenic
909236019 1:73153345-73153367 GAAAATGCTGATAGTGATAATGG - Intergenic
909971486 1:81995979-81996001 TGAAATGCTGTTAGGTATACTGG + Intergenic
911585554 1:99686052-99686074 TCAACTGCTGCTGTTTATAGAGG - Intronic
911689157 1:100811642-100811664 TATAATGGTGATAGTTGTAGTGG - Intergenic
912267508 1:108173766-108173788 CAAAATGCTGATAGTAATATGGG + Intronic
915592857 1:156880423-156880445 TAAAATGCAGCTAGGGATGGGGG - Intronic
915868150 1:159528129-159528151 TAAAATGCTGGTTGTTGTAGTGG + Intergenic
917167280 1:172126582-172126604 TTAAATGCTTCTAGAAATAGTGG + Intronic
917426783 1:174922866-174922888 TAAAATGTAGCCAATTATAGAGG + Intronic
917723702 1:177810741-177810763 TAAAACTCTGGTAGTTAGAGGGG + Intergenic
918366376 1:183812540-183812562 TAAAATACTCCTTGTTCTAGAGG + Intronic
918390447 1:184054238-184054260 TAAAATTCTTCTAGGTATAGTGG - Intronic
918817132 1:189201700-189201722 TAGAATAATGCTAGTTATATAGG + Intergenic
918867377 1:189920584-189920606 TCTAATGCTGCTTGTTGTAGAGG + Intergenic
919409787 1:197228546-197228568 CAAAATGCTGATAGTAATATTGG - Intergenic
920219807 1:204388654-204388676 TAAAATGTTGCTGGCTATAGGGG + Intergenic
920896078 1:210050533-210050555 TAAATTGCTACCAGTTAGAGTGG - Intronic
921387373 1:214584236-214584258 CAAAGTGCTGCTAGTGATACTGG + Intergenic
924267188 1:242294847-242294869 TAAAATGCTTCTACATATACTGG + Intronic
1066717629 10:38303659-38303681 TAAAATGCTTCTACATATACTGG - Intergenic
1068233839 10:54206400-54206422 TAAAATTCTGATAGTGATAAAGG + Intronic
1068711810 10:60143116-60143138 TAAATTGCTACTATTTATACTGG + Intronic
1072866578 10:99068105-99068127 CAAAATGCTGATAGTGATATGGG - Intronic
1072917858 10:99550666-99550688 TAATATGCTGCTATTTTTATTGG - Intergenic
1073555856 10:104450640-104450662 TGAACTGCTAGTAGTTATAGTGG - Intronic
1074133634 10:110607887-110607909 AAAAATTCTGCTAGGTATAGTGG + Intergenic
1075765475 10:124889576-124889598 TAAATTGCTATCAGTTATAGTGG + Intergenic
1076048281 10:127312521-127312543 TAAAATGCTGCATGTTATAAAGG - Intronic
1077825558 11:5805151-5805173 TAAACTGCTGCTGATTATAATGG + Intronic
1078967051 11:16357800-16357822 TAAAATGTAGCTAGTTATTATGG - Intronic
1080121646 11:28684823-28684845 TAACATGCATCTAGTTATATAGG + Intergenic
1080729080 11:34929893-34929915 TCAAATGCTGATAGTTACATTGG + Intronic
1081091670 11:38876791-38876813 TGAAATACTGATATTTATAGAGG - Intergenic
1081844058 11:46225639-46225661 TAGAAAGCTGCTAGTGATAGGGG - Intergenic
1082733212 11:56825391-56825413 CAAAATGCTGATAGTAATATGGG - Intergenic
1086992082 11:93314431-93314453 TAAAATGCTGATAGTGATATGGG - Intergenic
1087877389 11:103374582-103374604 CAAAATGCTGATAGTGATATGGG + Intronic
1090506603 11:127321514-127321536 TAAAATGCTGATAGTGTTATGGG - Intergenic
1091570334 12:1679791-1679813 TTATATGCTGGAAGTTATAGTGG + Intergenic
1092576880 12:9794347-9794369 TAAAATCCTGTTAGTAACAGCGG + Intergenic
1094421250 12:30273439-30273461 CAAAATGCTGATAGTAATATGGG - Intergenic
1095345992 12:41149041-41149063 CAAAATGCTGATAGTGATATGGG - Intergenic
1098122981 12:67262553-67262575 TAAAGTACTTTTAGTTATAGAGG - Intergenic
1098929169 12:76390396-76390418 TAAAAGTCTGCTATTTTTAGAGG - Intronic
1099066532 12:77987440-77987462 TAAATTGCTGCCAGTTATTAAGG + Intronic
1099078929 12:78150387-78150409 TAAATGGCTGCTAGACATAGTGG + Intronic
1099487693 12:83248739-83248761 CAAAATGCTGATAGTGATATGGG + Intergenic
1099655168 12:85479921-85479943 CAAAATGCTGGTAGTGATATGGG - Intergenic
1099658609 12:85526953-85526975 CAAAATGCTGATAGTGATATGGG + Intergenic
1100033893 12:90226890-90226912 GAAAATTCTGCTATTTATATTGG + Intergenic
1101190359 12:102326181-102326203 TAAAATGCTGATAGTGATATGGG + Intergenic
1103106134 12:118227445-118227467 TAAAATTATGCTACTTTTAGAGG - Intronic
1103750636 12:123157772-123157794 TAAAATGAGGCTGGGTATAGTGG - Intronic
1105528997 13:21201293-21201315 CAAAATGCTGATAGTGATATAGG - Intergenic
1107648836 13:42523739-42523761 CAAAATGCTACCAGTCATAGGGG + Intergenic
1108613347 13:52105985-52106007 TTAAATGCTGCTGGATATGGTGG - Intronic
1109285155 13:60399960-60399982 TAAAATACTGATTTTTATAGGGG - Intronic
1110286733 13:73758279-73758301 TAAACTACTGCTTCTTATAGGGG - Intronic
1111317281 13:86579694-86579716 AAAAATACTGCTATTTTTAGAGG - Intergenic
1111435717 13:88204291-88204313 TAAAATGAAGCTAGTCAAAGAGG - Intergenic
1111968823 13:94889111-94889133 AAAAATGCTGAAAGGTATAGAGG - Intergenic
1112859015 13:103807793-103807815 CAAAATGCTGGTAGTTACATGGG + Intergenic
1112950201 13:104985810-104985832 TAAAATGCTGCTTTCTATAGTGG - Intergenic
1114383519 14:22233166-22233188 CAAAATGCTGATAGTGATATGGG - Intergenic
1114887765 14:26875693-26875715 TAAAATGTTGTTAGTAATGGTGG + Intergenic
1115080031 14:29439042-29439064 TAAAATGCTGCTAGTCTTTGTGG - Intergenic
1115184466 14:30669412-30669434 TAAAATGCTGCTATTTGTGAGGG + Intronic
1115317389 14:32039335-32039357 TGAAATGCTGCAAGTTATCAGGG + Intergenic
1117925639 14:60776501-60776523 AAAAATGATGATAGGTATAGTGG + Intronic
1118006389 14:61567887-61567909 GAAAATGCTGCTACTTTCAGCGG + Intronic
1118373704 14:65158772-65158794 TAAAAATGAGCTAGTTATAGTGG + Intergenic
1120654240 14:87169935-87169957 CAAAATGCTGATAGTGATATGGG - Intergenic
1121567817 14:94923818-94923840 TAAGATGCTGCTATTGACAGGGG - Intergenic
1123140449 14:106072517-106072539 CAAAATGCTGATAGTGATATGGG + Intergenic
1124173680 15:27402386-27402408 TAAAATGCTGATATCCATAGAGG - Intronic
1126363133 15:47866491-47866513 TTAAATTCTGCTAGTTAGAATGG + Intergenic
1126825159 15:52541051-52541073 CAAAATGCTGATAGTGATATAGG - Intergenic
1127432872 15:58928610-58928632 TAAAATGATTCTATTTAGAGAGG - Intronic
1133921593 16:10158290-10158312 TAAAATGATGCCAGATACAGTGG - Intronic
1136662808 16:31780059-31780081 CAAAATGCTGGTAGTGATATGGG + Intronic
1138955489 16:61966187-61966209 TAAAATGGTGCTAATTTGAGAGG + Intronic
1139872813 16:70121075-70121097 TAAAATGTTGCTGGGTACAGTGG - Intronic
1140362963 16:74360247-74360269 TAAAATGTTGCTGGGTACAGTGG + Intergenic
1140413698 16:74758070-74758092 AAAAATGATGGTATTTATAGAGG + Intronic
1140582162 16:76243828-76243850 GAAGATACTGATAGTTATAGAGG - Intergenic
1141419768 16:83906087-83906109 AAAAATGCTGCCAGTTACGGCGG + Intronic
1144321843 17:14131010-14131032 TGACATGCTGCTAGGAATAGTGG - Intronic
1148543985 17:48502922-48502944 TCAAATCCTGCTACTTACAGAGG - Intergenic
1149364563 17:55929660-55929682 TATAATGCTGGTAGTTAGATAGG - Intergenic
1150528274 17:65947842-65947864 GAAAATGCTTCTATTTATATTGG + Intronic
1153244979 18:3065043-3065065 TAAAAAGCTGCTATTTCTACAGG - Intergenic
1156207986 18:34906702-34906724 CAAAATGCTGATAGTGATATGGG - Intergenic
1156307900 18:35896292-35896314 TAATATGCTGCTAGCAATATGGG + Intergenic
1157711702 18:49854161-49854183 TAAAATGGGGCTAGTAATAATGG - Intronic
1159026632 18:63188916-63188938 TAAAATGCTGCTATTAAGAAAGG - Intronic
1159799975 18:72886485-72886507 AAAAATGGTGCTAATTATACAGG + Intergenic
1161405249 19:4087984-4088006 TAAAATGCTGCATGTTTTACAGG + Intergenic
1163317006 19:16547606-16547628 TAAAATGCTGCTGGGTATGGTGG + Intronic
1164092813 19:21975270-21975292 TAAAATGCTGAAAGATATGGTGG + Intronic
1164676089 19:30102641-30102663 TAAAATGCTTATAATTTTAGGGG - Intergenic
1166017420 19:39993266-39993288 TAAAATGCTGATAGTGATAACGG + Intronic
1168117311 19:54230581-54230603 TAAAATGCAGTTAGTTTTCGGGG + Intronic
1168565315 19:57417476-57417498 TAAAATGCTGGTTGTTATTTTGG + Intronic
1202646751 1_KI270706v1_random:148882-148904 AATAATGCTGCTTATTATAGAGG - Intergenic
927167468 2:20338673-20338695 TGAAATGCTACTAGTTATGAGGG + Intronic
927561055 2:24074259-24074281 TAAAATGCCCCTAATTATAGGGG - Intronic
927816378 2:26221169-26221191 AAAAAAGCTGCTAGTTTAAGTGG + Intronic
929653641 2:43707321-43707343 GAAAAGGCTGCTAGTTATTAGGG - Intronic
929695198 2:44108807-44108829 TAAAATGTTGATAGGTATAACGG + Intergenic
930249243 2:49017084-49017106 TAAAATGCTGATATTTATCAAGG + Intronic
930939890 2:57000050-57000072 CAAAATGCTGATAGTGATATGGG - Intergenic
931027647 2:58131321-58131343 TCAAATGCTGCTAGTGTGAGTGG + Intronic
932658551 2:73631661-73631683 TGAATTGCTTCTAGTTTTAGTGG - Intergenic
932665161 2:73691672-73691694 TGAATTGCTTCTAGTTTTAGTGG - Intergenic
934071561 2:88389132-88389154 GAAAATGCTGCTGGTAAGAGAGG - Intergenic
936850889 2:116896334-116896356 AAAAATGCTGATAGTGATATAGG - Intergenic
936940785 2:117882293-117882315 CAAAATGCTGATAGTGATATGGG + Intergenic
939052473 2:137324548-137324570 CAAAATGCTTATAGTTAAAGGGG + Intronic
940070398 2:149680304-149680326 TAAACTGCTGCTGGTTAGATTGG + Intergenic
940288836 2:152058427-152058449 CAAAATGCTGATAGTGATATGGG + Intronic
940956403 2:159732861-159732883 TGAAATGGTGATAGTGATAGCGG + Intronic
942140449 2:172972300-172972322 TAAAATCCTGGTAATTATAGAGG + Intronic
942258354 2:174130213-174130235 ATAAATGCTGCTATTTATGGAGG + Intronic
943606428 2:189982824-189982846 TCAGATGCTGCTTGTTGTAGTGG + Intronic
945515967 2:210763542-210763564 CAAAATGCTGATAGTGATATGGG - Intergenic
947443079 2:230140392-230140414 CAAAATGCTGATAGTGATATGGG + Intergenic
1169922193 20:10747247-10747269 TAAAATGCAGCTAGTAAAACAGG + Intergenic
1172381989 20:34502228-34502250 AAATATGCTGCTAGGTATGGTGG + Intronic
1174700732 20:52605761-52605783 TAAAATGATGTTTGTTATTGGGG + Intergenic
1174784453 20:53419506-53419528 TAAAATGGAGCTAGTGATAATGG - Intronic
1177394180 21:20511550-20511572 TAAAATGCTGATAGTGATATGGG - Intergenic
1177614664 21:23501168-23501190 CAAAATGCTGGTAGTGATATGGG + Intergenic
1177628697 21:23699757-23699779 CAAAATGCTGATAGTGATATGGG + Intergenic
1179156464 21:38855975-38855997 CAAAATGCTGATAATAATAGGGG + Intergenic
949140860 3:630945-630967 TAAAATACTACTAGGTATAAAGG + Intergenic
950972369 3:17202083-17202105 CAAAATGCTGATAGTGATATAGG + Intronic
951437707 3:22684261-22684283 TATAATGCTGATAATTATACAGG - Intergenic
952128246 3:30328773-30328795 TGAAATGTTGATAGTTATGGAGG + Intergenic
952475981 3:33711145-33711167 TAAAATGAAGCCAGTTAAAGAGG + Intronic
954821796 3:53336085-53336107 TAAAATGCTGCCAGGCACAGTGG - Intronic
958175210 3:89988865-89988887 CAAAATGCTGATAGTGATATGGG + Intergenic
958889502 3:99767748-99767770 TAACATGCAGCAAGGTATAGAGG + Intronic
959229615 3:103631667-103631689 CAAAATGCTGATAGTGATATGGG + Intergenic
959518986 3:107304507-107304529 TAAAATGGTGGTATTTGTAGAGG + Intergenic
962356561 3:134699180-134699202 TAAAATGGTGCTAGGCACAGGGG - Intronic
962875299 3:139531454-139531476 TAAAATGTGCCTAGTTCTAGGGG - Intronic
962946354 3:140174337-140174359 CAAAATGCTGATAGTGATATGGG - Intronic
964215903 3:154281941-154281963 TGAAATGCTGTTAGTTAAAAGGG - Intronic
964520830 3:157564453-157564475 CAAAATGCTGATAGTGATACGGG - Intronic
964594373 3:158407076-158407098 TAAAATGCTACTGGTTATACAGG - Intronic
965708678 3:171535023-171535045 TTAAAAGCTGCTAGTTTTAGTGG - Intergenic
966741890 3:183241868-183241890 CAAAATGCTGATAGTGATATGGG + Intronic
968635518 4:1676496-1676518 TAAAATACAGCTTGTTTTAGGGG - Intronic
969152176 4:5178814-5178836 CAAAATGCTGATAGTGATATGGG - Intronic
970344116 4:15136635-15136657 CAAAATGCTGATAGTGATATGGG - Intergenic
970659329 4:18266179-18266201 CAAAATGCTGATAGTGATATTGG - Intergenic
972453543 4:39229626-39229648 TTAAATGCTGCTGTTTATTGGGG + Intronic
972693289 4:41420376-41420398 TAAAAATCTGCCAGATATAGAGG + Intronic
972896022 4:43620928-43620950 CAAAATGCTGATAGTAATATGGG - Intergenic
973542180 4:51945708-51945730 CAAAATGCTGATAGTGATATGGG + Intergenic
973760992 4:54115524-54115546 AATAGTGCTGCTAGATATAGGGG + Intronic
976824446 4:89245216-89245238 TTAAAAGCTGTTAGTTATATAGG + Exonic
976990705 4:91361548-91361570 TAAAAAGCTGTAAGTTATAATGG + Intronic
977378230 4:96236707-96236729 CAAAATGCTGATAGTGATATGGG + Intergenic
978141915 4:105327562-105327584 TAAAATGTTGCTAGTGTTAATGG - Intergenic
979206440 4:118044132-118044154 TAAAATGCTGCTATCTAAAATGG + Intronic
980029302 4:127808066-127808088 TAAAATGCTTCTAGTTCAAATGG - Exonic
980563778 4:134510947-134510969 TGAACTGCTGCTAGAGATAGTGG - Intergenic
980619185 4:135275507-135275529 TACAATGCTGTTTGTTAAAGTGG + Intergenic
981343249 4:143647051-143647073 TAAAATGTTGATAGTGATATGGG + Intronic
981391464 4:144196361-144196383 CAAAATGCTGATAGTGATACAGG + Intergenic
981412066 4:144443373-144443395 CAAAATGCTGTTAGTAATACGGG - Intergenic
981842887 4:149132918-149132940 TAAAATGCTGATAGTGATATGGG + Intergenic
982633683 4:157865322-157865344 TAAAATGATGCTAGGCATGGTGG - Intergenic
983477799 4:168236752-168236774 TAAAATTGTGCTATTTTTAGGGG + Intronic
983653381 4:170055545-170055567 TCAAATGCCGCTTGTTCTAGGGG + Intergenic
983660360 4:170125563-170125585 TAAAATGCTGATAATGATATTGG + Intergenic
983692254 4:170484399-170484421 TAACAAACTCCTAGTTATAGAGG + Intergenic
983766276 4:171488843-171488865 CAAAATGCTGATAGTGATATGGG + Intergenic
984479781 4:180285181-180285203 TAAAGTGATGTTAGTTAGAGAGG + Intergenic
986537426 5:8805375-8805397 CAAAATGCTGATAGTAATATGGG + Intergenic
987091945 5:14515971-14515993 TAAAATTCTGACAGTTGTAGGGG + Intronic
988038849 5:25861985-25862007 CAAAATGCTGATAGTAATATGGG - Intergenic
988876866 5:35456644-35456666 CAAAATGCTGATGGTGATAGGGG + Intergenic
989817323 5:45751751-45751773 CAAAATGCTGATAGTGATAATGG - Intergenic
990367244 5:55083794-55083816 AACAATGTTGCTATTTATAGTGG - Intergenic
990484143 5:56241635-56241657 CAAAATGCTGATAGTGATATGGG + Intergenic
992360205 5:76030069-76030091 TAAAATCCTTCTATTTAAAGTGG - Intergenic
993707860 5:91191906-91191928 TGAAATGCTGCTACGTAAAGTGG - Intergenic
994283608 5:97937540-97937562 CAAAATGCTGATAGTGATATGGG + Intergenic
994835048 5:104840524-104840546 TAAATTGCTTTTAGTAATAGTGG - Intergenic
995121919 5:108545449-108545471 TAAAATGATGTAAGTTTTAGGGG - Intergenic
996652516 5:125897468-125897490 AAAATTACTGCTTGTTATAGAGG + Intergenic
1000609540 5:163359281-163359303 CAAAATGCTGATAGTGATAATGG + Intergenic
1002813296 6:655755-655777 TAAAATGCTGCTGTGTAAAGCGG - Intronic
1003684888 6:8292698-8292720 TAAAATGGTGGGAATTATAGGGG + Intergenic
1007779200 6:44242698-44242720 TAAGAGGCTGCTTGTTCTAGGGG + Intergenic
1008172765 6:48230072-48230094 TAAGTTGCTGCTAGATCTAGAGG + Intergenic
1009563169 6:65275010-65275032 TGAAAAGCTGCTAGTTTGAGTGG + Intronic
1009641205 6:66339299-66339321 TAAAATGCTGATTGTTCTAAAGG - Intergenic
1010420548 6:75669787-75669809 TAAAATGCTGCTAGTTATAGTGG - Intronic
1010631899 6:78208182-78208204 CAAAATGCTGATAGTGATATGGG - Intergenic
1010875158 6:81094741-81094763 TTATATGCTGATAGTTATATTGG + Intergenic
1011895451 6:92218830-92218852 TAAAATGTAGCTAGTGATACAGG - Intergenic
1012987410 6:105889372-105889394 TAAAATAATGCTAGGTATAGTGG - Intergenic
1014605422 6:123467984-123468006 TAAAATGTGGATAGTTGTAGGGG + Intronic
1014660016 6:124158267-124158289 TATAAGGATGCTAGTTATATAGG + Intronic
1015147920 6:130007971-130007993 TAAAATGCTGCCTGTTCTAGTGG - Intergenic
1015239511 6:131007621-131007643 CAAAATGCTGATAGTAATATGGG + Intronic
1015624899 6:135170743-135170765 TAAAATGCTGCTGGTAGCAGTGG - Intergenic
1018994270 6:168699289-168699311 TCAGATGCTGCTAGTTATAGGGG + Intergenic
1019098759 6:169610087-169610109 CAAAATGCTGATAGTGATATGGG - Intronic
1020600390 7:10268134-10268156 TCAAATGCTGCTACTTCCAGGGG - Intergenic
1020843130 7:13246538-13246560 TAAAATGCTACTAGTGATACTGG - Intergenic
1024904600 7:54362302-54362324 TAAAATGGTGCTATTTGGAGGGG - Intergenic
1025042226 7:55656975-55656997 TAAAATGCTGCAAGTCATTTAGG - Intergenic
1028994423 7:97084685-97084707 AAAAATGGTGCAAGTGATAGTGG + Intergenic
1029064379 7:97834737-97834759 TAAAATGCTATTGGTTATTGAGG + Intergenic
1031287355 7:119886618-119886640 CAAAATGCTGATAGTGATATGGG - Intergenic
1031761402 7:125716907-125716929 TAAAACGCTGCTAGTTTTGAGGG + Intergenic
1034989681 7:155540451-155540473 TAAAATGAAGCTAATTACAGTGG + Intergenic
1036893878 8:12615122-12615144 CAAAATGCTGATGGTTATATGGG - Intergenic
1037516445 8:19636465-19636487 TAAAGTGGTGCTGATTATAGGGG - Intronic
1038729355 8:30113413-30113435 TAAAATGCTGCTAGCAAGCGTGG + Intronic
1038880541 8:31606076-31606098 CAAAATGCTGATAGTAATAAGGG - Intergenic
1040351239 8:46571304-46571326 TAAAATGCTATTGGTTATTGAGG + Intergenic
1040540120 8:48346346-48346368 CAAAATGCTGATGGTGATAGGGG + Intergenic
1040560306 8:48517778-48517800 TAAAAAGCTGCCTGTGATAGTGG + Intergenic
1042267021 8:66919356-66919378 TAAAATTCTGTTGGTTTTAGAGG - Exonic
1042859379 8:73297222-73297244 TAAAAACCTGCAAGTTACAGTGG - Exonic
1043863231 8:85346472-85346494 TAAAATTCTGCTAGGCATGGTGG + Intronic
1044006066 8:86938238-86938260 CAAAATGCTGATAGTGATATGGG - Intronic
1045849198 8:106673177-106673199 CAAAATGCTGATAGTGATAATGG + Intronic
1047457408 8:125028560-125028582 TAAAAAGATGCTAATAATAGTGG - Intronic
1048102609 8:131370486-131370508 AATAATGCTGCGAGTTATAGAGG + Intergenic
1049045382 8:140147042-140147064 GAAGATGCTGCTACTTTTAGTGG - Intronic
1051569089 9:18535343-18535365 CAAAATGCTGATAGTGATACAGG - Intronic
1052220715 9:26018288-26018310 TAAAATGCTGATAATGATATGGG - Intergenic
1055702791 9:78964157-78964179 TGAAATGCTGTTAAATATAGTGG - Intergenic
1058722156 9:107773933-107773955 CAAAATGCTGACAGTTATATGGG - Intergenic
1058791694 9:108453013-108453035 TGAAATGTTGATAGTTATGGAGG - Intergenic
1059581816 9:115557151-115557173 CAAAATGCTGATAGTGATATGGG - Intergenic
1059783196 9:117551550-117551572 TAAAAGGCTGCAAGTTAAACTGG + Intergenic
1060006015 9:120000524-120000546 TGAAATGCAGCTAGATATTGGGG + Intergenic
1060702625 9:125771524-125771546 TAAAATGGTGCAAATAATAGAGG + Intronic
1060709158 9:125839139-125839161 TAAAATGGAGATAATTATAGTGG + Intronic
1061089208 9:128417466-128417488 TCAAATGCTTCTAGTCATTGAGG - Intronic
1062078332 9:134604428-134604450 TAAAATGCTGATAGTCGAAGAGG - Intergenic
1187141113 X:16594473-16594495 TAAGATGTTGCTATTGATAGGGG + Intronic
1188749163 X:33884559-33884581 CAAAATGCTGATGGTTATATGGG + Intergenic
1191052379 X:56207635-56207657 CAAAATGCTGATAGTGATATGGG - Intergenic
1192412657 X:70948204-70948226 CAAAATGCTGATAGTGATATGGG + Intergenic
1193273263 X:79554184-79554206 CAAAATGCTGATAGTGATATGGG + Intergenic
1194064096 X:89240894-89240916 CAAAATGCTGATAGTGATAGGGG + Intergenic
1194410928 X:93556370-93556392 TTAAATGCTGCTTGTTGTAGTGG - Intergenic
1196900684 X:120380003-120380025 TAAAATTCTGTTGGTTTTAGAGG + Exonic
1197385343 X:125795037-125795059 CAAAATGCTGATAGTAATATGGG + Intergenic
1199413996 X:147558714-147558736 TAAAATGCTGATACTTATCTAGG + Intergenic
1200718271 Y:6574993-6575015 CAAAATGCTGATAGTGATAGGGG + Intergenic