ID: 1010438043

View in Genome Browser
Species Human (GRCh38)
Location 6:75858865-75858887
Sequence CTCATAATGACTCTTGGTTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 110
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 102}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1010438041_1010438043 4 Left 1010438041 6:75858838-75858860 CCTATGATAAATTTATATGAAGT 0: 1
1: 0
2: 4
3: 29
4: 392
Right 1010438043 6:75858865-75858887 CTCATAATGACTCTTGGTTCTGG 0: 1
1: 0
2: 0
3: 7
4: 102
1010438040_1010438043 27 Left 1010438040 6:75858815-75858837 CCATTATTACAATTACATTTTAT 0: 1
1: 0
2: 6
3: 78
4: 854
Right 1010438043 6:75858865-75858887 CTCATAATGACTCTTGGTTCTGG 0: 1
1: 0
2: 0
3: 7
4: 102

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1010438043 Original CRISPR CTCATAATGACTCTTGGTTC TGG Intronic
901429890 1:9207275-9207297 ATCATAGTGACTCTTCTTTCCGG + Intergenic
903404129 1:23082185-23082207 CTCGTAATGACTTTTGCTCCTGG + Intronic
904595280 1:31640582-31640604 CTCAAAGTGACTCTAGGTGCTGG - Intronic
909679090 1:78271206-78271228 CTAAAAATGACTCTTGCTTCTGG + Intergenic
910738289 1:90486739-90486761 CTCAAAAGGATTCTTGGATCAGG + Intergenic
921172168 1:212559382-212559404 CTCTTCCTGACACTTGGTTCAGG - Intergenic
1065520143 10:26564432-26564454 CTCATTATGACTCGTGTCTCAGG - Intronic
1067809336 10:49415214-49415236 CACAGAATGTCTCTTGGTTTGGG - Intergenic
1068401703 10:56536192-56536214 TTCATAATTACTCTTGGCACAGG - Intergenic
1073209292 10:101785863-101785885 CCTGTAATGACTGTTGGTTCAGG - Exonic
1073560866 10:104495798-104495820 CTCATAATACCTCCAGGTTCAGG - Intergenic
1073902744 10:108243186-108243208 CACATAATGACTCCTTGTTTGGG + Intergenic
1075932219 10:126309010-126309032 CCCAAAATAACTCTGGGTTCTGG - Intronic
1078260455 11:9701916-9701938 CTCATATTAAGTCTTGGTTTGGG + Intronic
1079971613 11:27042090-27042112 CTCATAATGAATATATGTTCTGG + Intronic
1080348131 11:31348673-31348695 TAGATAATGACTGTTGGTTCAGG + Intronic
1086854630 11:91851418-91851440 CTCATACTTCCTCTTGTTTCTGG + Intergenic
1092745120 12:11666003-11666025 CTCAGGATGCCTCTTGGGTCAGG + Intronic
1094492648 12:30970611-30970633 CTGATACTGACTTGTGGTTCTGG - Intronic
1099444691 12:82738743-82738765 CTAATAATTATACTTGGTTCTGG - Intronic
1100893901 12:99158153-99158175 CTCTAAAAGAATCTTGGTTCAGG + Intronic
1110839446 13:80125180-80125202 CTCATAGTGACTCTGAGTTTAGG - Intergenic
1110847396 13:80205944-80205966 CTCATAAAGACACTTGTTACAGG + Intergenic
1111544417 13:89712049-89712071 CTCATAATGAGTCTGGGATCTGG + Intergenic
1113314665 13:109165915-109165937 CTCAACATGGTTCTTGGTTCTGG - Intronic
1122792629 14:104190755-104190777 TTCATAACGACTCTTGGATAAGG + Intergenic
1127637519 15:60885487-60885509 CTCACAATGTTTCTTGGGTCAGG - Intronic
1127762071 15:62149304-62149326 CTGGTAATGGCTCTTGGTCCAGG - Intergenic
1129373268 15:75111050-75111072 CACAGAATGAGTCTTGGTCCTGG - Intronic
1135123108 16:19783718-19783740 CTCATACTTATTCTTGGTTTGGG + Intronic
1135904032 16:26493921-26493943 CTTTTAATGAATCTTGTTTCTGG + Intergenic
1137751495 16:50864270-50864292 CCCATAATGGCTCTTGGTGAAGG + Intergenic
1144292107 17:13836865-13836887 ATCATAATGACTTCTGCTTCTGG + Intergenic
1144871112 17:18371672-18371694 TTTATTATGTCTCTTGGTTCTGG - Intergenic
1146561273 17:33872313-33872335 CTCAGACTGACACTTGGTTCAGG - Intronic
1146965414 17:37024501-37024523 CTCATATTCACTTTTGGTGCTGG - Intronic
1151572190 17:74932353-74932375 CTAAGAATGACTCTTAGTTAGGG - Intronic
1157855074 18:51097989-51098011 CTCATGATCCCTCTTGCTTCCGG + Intergenic
1161252229 19:3286280-3286302 CAGAGAATCACTCTTGGTTCTGG - Intronic
1163966654 19:20752619-20752641 GTCATAATGACTCCTGTTCCGGG + Intronic
1166667901 19:44692275-44692297 ATCATAGTGACTCTTGGTCATGG - Intergenic
926750533 2:16195504-16195526 CTCATCCTGAATCTTGGTTGGGG - Intergenic
927050666 2:19324995-19325017 CTAATAATGCCTCGTTGTTCTGG - Intergenic
931617317 2:64173209-64173231 CTCTTAATCTCTCTTGGTTCTGG + Intergenic
931792137 2:65673404-65673426 CACATAATCACTCCGGGTTCAGG + Intergenic
935407412 2:102723566-102723588 CTCAAAATGACTTTTGTTTTTGG + Intronic
936679338 2:114752657-114752679 GTTAAAATGACTCTTGGTCCAGG + Intronic
937671556 2:124542895-124542917 CTCAACACGACTCTTGGTTTTGG + Intronic
940871901 2:158867573-158867595 GTCATAATGACTCCTGTTCCGGG - Intergenic
943367941 2:186983074-186983096 CTGATAATGACACTAGGTTAAGG - Intergenic
944951737 2:204758281-204758303 CTCATACTGACTCTGGGCTTGGG - Intronic
945610622 2:211996937-211996959 CTGACAATTACTCTTGGTTAAGG + Intronic
948064697 2:235068565-235068587 TTTAAAATCACTCTTGGTTCAGG - Intergenic
1169723895 20:8708487-8708509 CTAATTCTGACTCTTGATTCTGG - Intronic
1181325562 22:22043213-22043235 CTCATTATGACTCTGGGTCGGGG - Intergenic
954581668 3:51706520-51706542 CTCATAGTGACTCTGGCTCCAGG + Intergenic
956692501 3:71891077-71891099 CTCATTGGGAATCTTGGTTCAGG + Intergenic
957412472 3:79859382-79859404 CTCATAATGCCTGTAGTTTCTGG - Intergenic
959134858 3:102405147-102405169 CTTATTATGACTCTTGCTTTGGG - Intronic
961191533 3:124966520-124966542 CTCAGAATGACACTTTGTTAAGG + Exonic
961274812 3:125718476-125718498 GTCATAATGACTCCTGTTCCAGG - Intergenic
961277731 3:125741107-125741129 GTCATAATGACTCCTGTTCCGGG - Intergenic
964154858 3:153572962-153572984 CCCATGATGACTCTGGCTTCTGG - Intergenic
965531909 3:169779334-169779356 CTCATAAGGACTCTTGACGCTGG - Exonic
966665244 3:182464486-182464508 CTCACAGTGAGGCTTGGTTCAGG + Intergenic
973956149 4:56065382-56065404 ATCATAAAGACTCATGGTGCTGG - Intergenic
977739798 4:100465412-100465434 CTCATACTTACTCTTGGGTTTGG + Exonic
979911078 4:126366381-126366403 CTAAGAATTTCTCTTGGTTCTGG + Intergenic
980743450 4:136982235-136982257 CTCAGAATTAGTCTTGGTTTAGG + Intergenic
983164116 4:164452953-164452975 CTCATAATGTCAGTTGGTTAGGG - Intergenic
983901135 4:173135706-173135728 CTCATAATTATCCTTGGTTTGGG + Intergenic
987323327 5:16790228-16790250 TACAGAATGACTGTTGGTTCAGG - Intronic
993897138 5:93549581-93549603 CTCATAATGACACACAGTTCAGG + Intergenic
1000774263 5:165397913-165397935 CTCTGAATGACTGATGGTTCTGG + Intergenic
1003487686 6:6593825-6593847 CTCATGATGCCCCTTGGTGCAGG + Intronic
1004606223 6:17197363-17197385 CCCATATTGACTCTGGGCTCGGG + Intergenic
1005249798 6:23931364-23931386 CTCATAAGCACTGTTGCTTCTGG + Intergenic
1005411426 6:25551716-25551738 CTCATAATGTTTCTTAGTTGGGG + Intronic
1006894063 6:37454974-37454996 GTCATAATGGCTCTTGGATCAGG + Intronic
1007018075 6:38489647-38489669 CTCATAATCACTGTTGGTGAGGG - Intronic
1010438043 6:75858865-75858887 CTCATAATGACTCTTGGTTCTGG + Intronic
1011548501 6:88506519-88506541 CTAATAATGACTATTGTTGCAGG + Intergenic
1014069597 6:117166304-117166326 CTGATAATGACCCCTGGTTCAGG - Intergenic
1014699879 6:124671781-124671803 CTCTTAATGGCTATTGATTCTGG + Intronic
1017511814 6:155121257-155121279 CTCATAATAACTGCTGTTTCAGG - Intronic
1017677276 6:156827181-156827203 CTCATTATGTCTCTTCCTTCTGG + Intronic
1018461651 6:164004638-164004660 TTCAGAATGACTCTTGCTTCAGG + Intergenic
1023559950 7:41463346-41463368 CTCATAATTTTTCTGGGTTCTGG + Intergenic
1029916899 7:104219556-104219578 CTCATAATGACCCTTTGTGTAGG - Intergenic
1031193423 7:118584554-118584576 CTCTTAATGATCCTTGGTTAAGG + Intergenic
1031399029 7:121309449-121309471 CTCATAAGGACCCTTGTTACAGG + Intergenic
1032745427 7:134781648-134781670 CTCTTAGTGACTTTTTGTTCTGG - Intronic
1034766771 7:153731178-153731200 CTCATAATATGCCTTGGTTCAGG + Intergenic
1048163747 8:132043854-132043876 CTCAGAATTACTTTTGGGTCGGG - Intronic
1048854581 8:138675382-138675404 CTCTTAATCACTCTTGGTCGTGG + Intronic
1050583356 9:7084332-7084354 CTCATGTTGAATCTTGGTTGTGG - Intergenic
1053516008 9:38731503-38731525 CTCACAATGACCCTAGGATCTGG + Intergenic
1056917473 9:90757854-90757876 GTCATAATGACTCCTGTTCCGGG + Intergenic
1057090471 9:92253599-92253621 CACATAATGACTGTTTGTTGAGG + Intronic
1061772717 9:132938701-132938723 CTCATAATGCATCTTGGCTAGGG - Intronic
1062006983 9:134243799-134243821 CACTTAATGACTATTGCTTCTGG + Intergenic
1190520739 X:51277162-51277184 CTCTTAATGACTCTAGGCTGAGG - Intergenic
1196870787 X:120111293-120111315 CTCACAATCACACCTGGTTCGGG - Intronic
1200850392 Y:7877216-7877238 CTAATAATGACTCTTGTACCTGG - Intergenic
1200866226 Y:8046595-8046617 CTAATAATGACTCTTGTACCTGG + Intergenic
1200897505 Y:8391287-8391309 CTAATAATGACTCTTGTACCTGG - Intergenic
1200900918 Y:8431064-8431086 CTAATAATGACTCTTGTACCTGG - Intergenic
1202259644 Y:22957073-22957095 CTAATAATGACTCTTGTACCAGG + Intergenic
1202412630 Y:24590817-24590839 CTAATAATGACTCTTGTACCAGG + Intergenic
1202458150 Y:25079253-25079275 CTAATAATGACTCTTGTACCAGG - Intergenic