ID: 1010446227

View in Genome Browser
Species Human (GRCh38)
Location 6:75951538-75951560
Sequence TGGAAAGTGAATAAAATTTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 479
Summary {0: 1, 1: 0, 2: 4, 3: 37, 4: 437}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1010446227_1010446230 17 Left 1010446227 6:75951538-75951560 CCAGAAATTTTATTCACTTTCCA 0: 1
1: 0
2: 4
3: 37
4: 437
Right 1010446230 6:75951578-75951600 TTTATGCAATTGGATTTTTTTGG 0: 1
1: 0
2: 6
3: 49
4: 503
1010446227_1010446229 7 Left 1010446227 6:75951538-75951560 CCAGAAATTTTATTCACTTTCCA 0: 1
1: 0
2: 4
3: 37
4: 437
Right 1010446229 6:75951568-75951590 AAGTCTGCATTTTATGCAATTGG 0: 1
1: 0
2: 3
3: 23
4: 196

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1010446227 Original CRISPR TGGAAAGTGAATAAAATTTC TGG (reversed) Intronic
902549523 1:17210999-17211021 TGGAGAGTTAAACAAATTTCAGG + Intronic
903300147 1:22373015-22373037 GGAGAAGTGAATAAAATGTCTGG + Intergenic
904761629 1:32809002-32809024 GTAAAAATGAATAAAATTTCAGG + Intronic
906811799 1:48834568-48834590 TAGAAAGAGAAAAAGATTTCTGG - Intronic
908898922 1:68933067-68933089 TGGAAAAAGAATCAAAGTTCTGG - Intergenic
909054075 1:70802674-70802696 TGGAAGGTGATTAAAATATGGGG + Intergenic
909151858 1:72016521-72016543 TGGAAAGTTTTTAAAGTTTCTGG + Intronic
909263793 1:73530266-73530288 GGGAAAGTTTGTAAAATTTCTGG - Intergenic
909496397 1:76283741-76283763 TGGAGAGTGAATAGAAATACAGG + Intronic
909747653 1:79118670-79118692 TGAAAAGGGATTAAAGTTTCTGG - Intergenic
909747780 1:79120377-79120399 TGAAAAGGGATTAAAGTTTCTGG - Intergenic
910136379 1:83976190-83976212 TAGAAAATGAATAACATTTCTGG - Intronic
910992076 1:93066978-93067000 TGGAAAAAGAATAAAAGCTCTGG + Intergenic
911199886 1:95033707-95033729 TGGAATGTGTATAAAAGTTTTGG - Intronic
912332543 1:108832815-108832837 TGGAAAAAGAAAAAAATGTCTGG + Intronic
912574733 1:110657501-110657523 TAGAAAGTGAATAAATATTCTGG + Intergenic
912779918 1:112536475-112536497 TGAAAAGTGAACAAAACTTTTGG - Intronic
912880235 1:113404958-113404980 TTAAAAGTAAATAAAATTCCAGG - Intronic
915059312 1:153167172-153167194 TGGAAAAAAAATAAAATCTCTGG + Intergenic
915264738 1:154708849-154708871 TGTAAAGTGAATTAACTCTCAGG + Intronic
916434651 1:164766691-164766713 AGGAAAGAAAAGAAAATTTCTGG - Intronic
916498877 1:165369536-165369558 TGGAAAGAGAACAAAAGTTTGGG - Intergenic
918054339 1:181005974-181005996 TGGAAATTGAATGAGATTTTGGG - Intronic
918420340 1:184358426-184358448 TGGCAAGGGAATAGATTTTCTGG + Intergenic
918852934 1:189715799-189715821 TAGAGAGAGAATAAAATTTGAGG + Intergenic
918953807 1:191178318-191178340 TTGATAGTGATTAAAATTACTGG + Intergenic
919174680 1:194003424-194003446 TGGAAAGAGGATAAGATATCTGG + Intergenic
919388549 1:196953035-196953057 TGGAGAGTTAATAAAGTTTCAGG + Intronic
919391020 1:196986148-196986170 TGGAAAGTTAATAAAGTTTCAGG + Intronic
920064954 1:203262356-203262378 TGCAAAGAGAATAAAATACCTGG + Intronic
921278144 1:213539452-213539474 TGGAAAGTAAATAGGATTTTTGG + Intergenic
921279822 1:213555389-213555411 TGCAAAGTGCATAAAATGGCAGG - Intergenic
921825068 1:219663300-219663322 TAGAAAGTGAAAGTAATTTCTGG - Intergenic
921836721 1:219785897-219785919 TGGAAACATAATAAATTTTCAGG + Intronic
922033757 1:221828488-221828510 TGAAAAGAAGATAAAATTTCAGG + Intergenic
922331546 1:224581152-224581174 TGAAAGGAAAATAAAATTTCAGG - Intronic
922678340 1:227567730-227567752 TGGAAAATAAAGAAAAATTCTGG - Intronic
923327932 1:232897342-232897364 TGAAAAGAAAATAAAATTCCGGG + Intergenic
923448444 1:234094160-234094182 TGGAAAGAGAATCAAATTCTGGG - Intronic
923851847 1:237804590-237804612 TGGAAAATGAATACACTTTTGGG - Intronic
923889566 1:238197737-238197759 TGGGAAGAAAATAAAATTTTAGG + Intergenic
924657947 1:245990466-245990488 TCGACCTTGAATAAAATTTCTGG + Intronic
1063734468 10:8736973-8736995 TGCAAAGTGAATAAAAATGTTGG + Intergenic
1064135680 10:12748525-12748547 TGGAATGTGAATAAAAACACTGG + Intronic
1064810422 10:19191689-19191711 TACAAAGTGAATAAAACTTGAGG + Intronic
1065244752 10:23745936-23745958 TGTAAAGGGCATAAAATATCAGG - Intronic
1065565428 10:27002811-27002833 TGCAAAGTGAAAAAATTGTCAGG - Intronic
1067818698 10:49506823-49506845 TTGAAAGTGAATAGAATTTGAGG - Intronic
1068242993 10:54328876-54328898 TGGAAGTTTAATAAAATTTCTGG - Intronic
1069342680 10:67430530-67430552 AGGAAAGTAAAAAAAAATTCTGG - Intronic
1070484519 10:76916692-76916714 TGGAAAGTGAGTCAGATATCTGG - Intronic
1071088360 10:81890761-81890783 TGAAAATTGAATTAAATTGCCGG + Intronic
1072937567 10:99728040-99728062 TGGAATGTGAAGAGAATTTGAGG + Intronic
1072981732 10:100103691-100103713 AGGGAAGTGAATAAAATTGCTGG + Intergenic
1074091513 10:110263278-110263300 TGGAAAGGGAATATATTTGCAGG - Intronic
1074148994 10:110741670-110741692 TGGGAATTGAAAACAATTTCAGG - Intronic
1074735528 10:116427836-116427858 TGCAAAGTAAATAAAATTATCGG - Intergenic
1074803349 10:117024927-117024949 TGAAAACTTAATAAAATTTTGGG + Intronic
1075039999 10:119100465-119100487 TGGAAAGTGCCTAAACTGTCTGG - Intergenic
1075180707 10:120208166-120208188 TGGAAAAAGAATAATATTCCAGG - Intergenic
1075934708 10:126329821-126329843 TGGAAAGTGATAAAAATCTATGG - Intronic
1076708823 10:132319755-132319777 TGTAAATTGAATAAAAATTGTGG + Intronic
1078001921 11:7503724-7503746 AGGAAAGGGAAGATAATTTCAGG + Intronic
1079720823 11:23811695-23811717 TGAATAGTGAATAAAATTTATGG - Intergenic
1079723996 11:23856454-23856476 TAGAAAATGAACAAAATTTGGGG - Intergenic
1080030647 11:27657096-27657118 TAGAAAGTGAATAAAAATTAAGG - Exonic
1080393142 11:31866296-31866318 TGGAAAGGGAAGAAAGTGTCAGG - Intronic
1080939157 11:36895419-36895441 TGGAAAGTGTTTAAAATATTTGG + Intergenic
1082614683 11:55344303-55344325 TGGAGAATGAATAAAATCACAGG + Intergenic
1082844118 11:57713386-57713408 GCGAAAGTGGATAAAATTTGGGG + Intronic
1085013242 11:73155962-73155984 TGGAAAGGGCATTAAAGTTCAGG + Intergenic
1085193956 11:74655101-74655123 TGGGAAATGCATAAAAATTCAGG - Intronic
1086597950 11:88596616-88596638 TAGAAAATGAATATGATTTCAGG - Intronic
1086731360 11:90253780-90253802 TAAAAAGTCAATAAAATTACAGG - Intergenic
1086934427 11:92729307-92729329 TGAAAAAATAATAAAATTTCAGG - Intronic
1087267232 11:96073963-96073985 TGAAAAGTGAATAAATTTAACGG - Intronic
1087567436 11:99879233-99879255 TGGCCAGTGAAGATAATTTCTGG + Intronic
1087767961 11:102176859-102176881 TGGAAAGTGCATGACACTTCTGG + Intronic
1087783541 11:102328023-102328045 TGTAAAGAAAATAAAATTTGAGG - Intronic
1088151759 11:106754091-106754113 TGCAAAGAGAATAAAATACCTGG - Intronic
1088987457 11:114922239-114922261 AGGACAATGACTAAAATTTCTGG + Intergenic
1089345967 11:117792087-117792109 TGGATAATGAATAAAAGCTCTGG + Intronic
1090933105 11:131316925-131316947 TGCAAAGAGAATAAAATACCTGG + Intergenic
1091961413 12:4698207-4698229 TGAAAAGAAAATAAAATCTCAGG + Intronic
1092174840 12:6396582-6396604 TGGAAAAGGCATCAAATTTCTGG + Intergenic
1092666795 12:10809549-10809571 TTCAAAGTGAGTAAAATTCCAGG - Exonic
1093344150 12:18019669-18019691 TGAAAAGAAAATAAAATCTCAGG + Intergenic
1093424667 12:19014840-19014862 TATAAAGTGAATAAAAGTACTGG - Intergenic
1093889332 12:24500792-24500814 TGGAAAGTGTGTAAAAATGCCGG - Intergenic
1094060839 12:26314142-26314164 TGGAAAGTGAAAAAAAAAGCAGG - Intergenic
1094730198 12:33165600-33165622 TGGAAAGTGAAAAAAAGAGCAGG + Intergenic
1095288463 12:40445619-40445641 CTAAAAGTGAAGAAAATTTCTGG - Exonic
1095433286 12:42157750-42157772 TAAAAAGTGAATATAATTTGAGG - Exonic
1097884745 12:64717780-64717802 TGGAAAAGGCATAAAATTTGTGG + Intronic
1097945546 12:65364116-65364138 TGGAATGTGAATGTAATTCCAGG - Intronic
1098391040 12:69970313-69970335 TGGAAAGTGGAGAAAATAACTGG + Intergenic
1098815064 12:75149451-75149473 TTAAATGTGAATAAAATTTCAGG + Intronic
1100102204 12:91122615-91122637 AGGAAAGTGAATAAAATACGTGG + Intergenic
1100314743 12:93434601-93434623 TTGATAGTGATTAAACTTTCAGG - Intronic
1101070409 12:101069061-101069083 TGGAAAGCTATTCAAATTTCTGG - Intronic
1104319597 12:127738340-127738362 TGGGGAGTAAATAATATTTCAGG - Intergenic
1105276918 13:18938690-18938712 GTGAAATTGAATTAAATTTCAGG - Intergenic
1106197616 13:27507839-27507861 TGAGAAGAGAATAAAATCTCTGG + Intergenic
1106315753 13:28591774-28591796 TGCAAAGTGAAGAAAAGTTCTGG + Intergenic
1106476956 13:30107413-30107435 TGGAAAGGGAAGGAAATTTAAGG - Intergenic
1107148110 13:37081460-37081482 TGGGAAGAAAATAACATTTCTGG + Intergenic
1107762939 13:43700778-43700800 TGGAAATTGAATATGATTTAAGG + Intronic
1108423043 13:50270470-50270492 TTGAGAGGGAATAAAATTTATGG - Intronic
1108826104 13:54414621-54414643 TGAAAATAGAATAGAATTTCTGG + Intergenic
1110005961 13:70269687-70269709 TGAAAAGAGAATTAAATTGCAGG + Intergenic
1110095683 13:71517097-71517119 TAGAAAGTGATAATAATTTCTGG + Intronic
1110894195 13:80728755-80728777 TGGAAAATGCATAGAATTTAAGG + Intergenic
1111108773 13:83679920-83679942 TGCAATGTGAACAAAATTTCAGG + Intergenic
1111446314 13:88349136-88349158 CTGAAAGTGAATAAAATTATTGG - Intergenic
1111506458 13:89196031-89196053 TACAAAGAGAATAAAATATCTGG + Intergenic
1111969017 13:94891182-94891204 AGGAAACTGAAAAACATTTCCGG - Intergenic
1112883810 13:104143969-104143991 TGGGAACAGAATAAACTTTCAGG + Intergenic
1113234812 13:108260100-108260122 AGAAAAATGAAGAAAATTTCTGG + Intronic
1114148364 14:20005690-20005712 TGTTAAGTGAATAATATTTTAGG - Intergenic
1115057430 14:29147168-29147190 TGCAAAGTGAATAAAGTTATTGG - Intergenic
1115312182 14:31990302-31990324 GGGAAAGTGAGTCAAAATTCTGG - Intergenic
1115798261 14:36963116-36963138 AGGAAAGTGAAAAATATTTCTGG - Intronic
1116205424 14:41859313-41859335 TAGAAAGTGAATAAAAGTCTGGG - Intronic
1116420418 14:44726027-44726049 TGGAAAGTAAAAAAAAATTATGG - Intergenic
1117066956 14:52020731-52020753 TGGAAAGTAAAGAAAATACCTGG - Intronic
1117168481 14:53066003-53066025 TGAAATGTGTATAAAGTTTCCGG - Intronic
1117308628 14:54500486-54500508 TGAAAAGAAAATAAAATTTCAGG - Intergenic
1118900722 14:69983212-69983234 TGGAGAGAGAATAAGATTTAGGG + Intronic
1119953551 14:78770826-78770848 TGTAAAGTGTATAAATTTTGGGG + Intronic
1120078362 14:80186406-80186428 TGTAAAGTGAAGTAAATTTAAGG - Intergenic
1120092602 14:80350299-80350321 TGGAAAGTTAAAAAAAATACAGG + Intronic
1120444817 14:84581047-84581069 TGAAAAGAGAAGAAAATTTTTGG - Intergenic
1121605048 14:95234421-95234443 TGGAAACTGTATAAAGTTTATGG - Intronic
1124561642 15:30779651-30779673 TTCAAAGAGAATAAAATATCTGG + Intergenic
1124783782 15:32660096-32660118 TGGTCAGTGAATAGAATTTTTGG + Intronic
1125996507 15:44166363-44166385 TAGAAAGTGAGTAAAAATTTAGG - Intronic
1126868199 15:52959096-52959118 TGCAATGTGATTAAAATTTATGG - Intergenic
1127325539 15:57891510-57891532 TGGTTAGTGATTAAAATTTTTGG - Intergenic
1127885524 15:63196337-63196359 TGGAAAATGAAAATAATTTAAGG - Intronic
1128379488 15:67101770-67101792 TTGAATGTGAATGATATTTCTGG + Intronic
1128814168 15:70593989-70594011 TGTAAAGTAACTAAAATTTCTGG - Intergenic
1129422949 15:75444162-75444184 TGGAAAAAAAATAAATTTTCAGG + Intronic
1130523207 15:84680542-84680564 TAAAAAGTGTCTAAAATTTCAGG - Intronic
1130805558 15:87317726-87317748 TGAAATGTGTATAAAATATCAGG + Intergenic
1131204796 15:90434549-90434571 TGGAATGTGACTTAATTTTCAGG + Intronic
1131340212 15:91591796-91591818 TGGATAGAAAATAAAATCTCAGG - Intergenic
1133368378 16:5228996-5229018 TGGGAAGTGAACAAAAATGCTGG - Intergenic
1133480880 16:6169343-6169365 TGGAGAGAAAAGAAAATTTCGGG + Intronic
1133535277 16:6696075-6696097 TGAAAATTGAATTAAATTACAGG + Intronic
1135495036 16:22943922-22943944 TGGGAAGGGAATAACATTTCGGG + Intergenic
1135628675 16:24018377-24018399 TGGAAACTGCATAAAGTTGCTGG - Intronic
1135906141 16:26513588-26513610 TGGACAGGGAATAAAATGTAGGG + Intergenic
1137658517 16:50182729-50182751 TGAAAAGTAAATAACTTTTCAGG - Intronic
1138841756 16:60517268-60517290 TAAAAAGAGAATAAAAATTCTGG + Intergenic
1140561184 16:75983699-75983721 TTGAAACAGAATCAAATTTCTGG + Intergenic
1140956823 16:79874142-79874164 TGGAAAGTGTATAAAAAGTTTGG + Intergenic
1141268152 16:82515663-82515685 TGGAAAGCAGATAAAATCTCTGG + Intergenic
1141540623 16:84717967-84717989 TGGAAAGGGTATATAATTTATGG + Intronic
1143715797 17:8768040-8768062 TGGAATGTCAATCAAGTTTCAGG - Intergenic
1144316961 17:14070656-14070678 TGACAAGTGAAAAAAGTTTCTGG - Intronic
1146562806 17:33886088-33886110 TGGAAAGCCACTAAAATTTTGGG - Intronic
1146803889 17:35849782-35849804 TAGAAAGTTAATAAAAATTGGGG + Intronic
1147552543 17:41454343-41454365 TGGCAGGTGAATAAAAGCTCTGG - Intergenic
1151142607 17:72008796-72008818 TGTAAAGTGAATAAAATGAATGG + Intergenic
1151243491 17:72776372-72776394 TGGAAAGTGTATAGAATATTTGG - Intronic
1152508263 17:80767541-80767563 TGTTAAGTAAATTAAATTTCTGG + Intronic
1154460064 18:14574327-14574349 TTCAAAGAGAATAAAATATCTGG - Intergenic
1155000976 18:21686571-21686593 TGGAAAGTGGATCATAGTTCTGG + Intronic
1156121068 18:33843577-33843599 TGAAAGGTAAATAAAATCTCAGG - Intergenic
1156138913 18:34080804-34080826 TGGAAAGAAAATAAAATGTAAGG + Intronic
1156195708 18:34771780-34771802 TGGAAAGTTAACAAAAAATCTGG - Intronic
1156725927 18:40127115-40127137 TGTAAAGTCAAGAAAATTTGTGG + Intergenic
1157068916 18:44383163-44383185 TAGGAAGTGAAGACAATTTCTGG - Intergenic
1157504138 18:48214237-48214259 GGGAAAATGAAAAAAAGTTCTGG - Intronic
1157955482 18:52092831-52092853 TGGAGTGTTAGTAAAATTTCAGG - Intergenic
1158149461 18:54351329-54351351 TGATAAGTGAATAAAGTTTCAGG - Intronic
1158637131 18:59169830-59169852 TGTAAATTCAATAAAATTGCAGG + Intergenic
1159375465 18:67586740-67586762 AGAACAGTGAGTAAAATTTCAGG - Intergenic
1159703854 18:71662692-71662714 TAAAAAGTCAATAACATTTCTGG - Intergenic
1162245176 19:9394037-9394059 TGGAAAGAAAAAAAAATTGCCGG + Intergenic
1164455709 19:28404904-28404926 TGAAAAGAAAATAAAATCTCGGG - Intergenic
1164470832 19:28530375-28530397 AGCAAAGTAAATAAAACTTCAGG + Intergenic
1165219977 19:34307451-34307473 TGAAAAGTCAATAAAAATGCTGG - Intronic
925664653 2:6239851-6239873 TGAAAAGAGAATAAATATTCGGG - Intergenic
926837751 2:17043219-17043241 TGAAATTTTAATAAAATTTCTGG + Intergenic
927047474 2:19294364-19294386 TGTCAAGAGAATAAATTTTCAGG - Intergenic
927287635 2:21372940-21372962 TGGAAATTGAGTAGAAGTTCAGG + Intergenic
928337364 2:30409136-30409158 TGGAAAGTAAATCAAATCTGAGG - Intergenic
928630317 2:33184938-33184960 TGGATAGTGAATCAGATTTGTGG + Intronic
928670682 2:33600012-33600034 TAGACAGTGAATAAACTTTTTGG + Intergenic
929016837 2:37505831-37505853 TGGAAAGTGCAAAAAAGTTCGGG - Intergenic
929270464 2:39965875-39965897 GGAAAAGTAAAGAAAATTTCAGG - Intergenic
929758018 2:44784324-44784346 TGAAAAGTAAAAAAATTTTCTGG + Intergenic
931790828 2:65662569-65662591 TGGAAAGTTACTAAAAATTCAGG - Intergenic
931853367 2:66276134-66276156 TGGAAAGGGAATATATTTTCTGG - Intergenic
932499272 2:72168152-72168174 TGGAAAGTGAATGTGATGTCTGG + Intergenic
933043947 2:77509395-77509417 TGCAAGGTGAATAAAATGTTCGG + Intronic
933297849 2:80510680-80510702 TTGAAAGTAAATCAATTTTCAGG + Intronic
934075556 2:88425944-88425966 TTGAAAGACAGTAAAATTTCAGG - Intergenic
935175919 2:100648628-100648650 TGGACAGTGAACAAAAGCTCAGG + Intergenic
936704112 2:115050533-115050555 GGGGAAGTGAATAAAAGTTGGGG + Intronic
937209283 2:120257976-120257998 AGGAAAGTGACTAAATTTTAGGG - Intronic
937343884 2:121110723-121110745 TGGAATTTGAATGAGATTTCTGG + Intergenic
937791464 2:125967080-125967102 TGGAAGGTGAATAAAAATTCAGG - Intergenic
939767923 2:146276365-146276387 AAGAAAGTGATTAAAATTTCAGG + Intergenic
939930746 2:148230472-148230494 TGGCTATTGAATAGAATTTCTGG - Intronic
940546704 2:155098417-155098439 TAAAAAATGAATAGAATTTCAGG - Intergenic
940588280 2:155685105-155685127 TGTAATCTGGATAAAATTTCAGG + Intergenic
940743361 2:157538355-157538377 TGGAAAGTCACTGAGATTTCAGG + Intronic
940924385 2:159347712-159347734 CAGAAAGTGAATAAAATTCTAGG + Intronic
941394218 2:164955148-164955170 TGCAAGGTGAATGAAATTTCCGG + Intronic
941710788 2:168711133-168711155 TGGAAAGTGCCTAACATTTATGG - Intronic
942613391 2:177764506-177764528 AGGAAAGTCCATAAAATTACAGG + Intronic
943413312 2:187566188-187566210 TAGAAATAAAATAAAATTTCAGG + Intergenic
943815099 2:192243942-192243964 TGGGAGGTGAATAAAATTCCAGG - Intergenic
945363558 2:208923059-208923081 TGTAATTTCAATAAAATTTCAGG - Intergenic
945540429 2:211079866-211079888 TAGGAAGTAAATACAATTTCAGG + Intergenic
946555898 2:220856749-220856771 AGGAAAGTGAACAGCATTTCTGG - Intergenic
947022835 2:225701044-225701066 TGGAAAGTGACTGAAAGATCTGG + Intergenic
1168775332 20:442582-442604 TGAAATGTGAATAAAATCTGTGG + Intronic
1169632973 20:7654158-7654180 TGGAAATTGAAATAAATTACCGG + Intergenic
1169649700 20:7853382-7853404 GGTAAAGTGATAAAAATTTCTGG + Intergenic
1169805754 20:9557736-9557758 TGGAAAGGAAATAACATTTAAGG + Intronic
1171188272 20:23138967-23138989 TGGAGAATGAACAATATTTCAGG - Intergenic
1173386470 20:42592924-42592946 TGGAAAGGGAAGAAAAGTTTGGG - Intronic
1176422135 21:6524679-6524701 TTAAAAGCAAATAAAATTTCAGG - Intergenic
1176672320 21:9745871-9745893 TGGGAAGAGAATAAAAACTCGGG - Intergenic
1176814048 21:13578505-13578527 TTCAAAGAGAATAAAATATCTGG + Intergenic
1176880139 21:14182388-14182410 TGGAGTGTGAATATTATTTCTGG + Intronic
1177534651 21:22407855-22407877 TGGCAAGTGAAGATAATTTGGGG - Intergenic
1177558783 21:22723933-22723955 GGGAGAATGAAGAAAATTTCTGG - Intergenic
1177583848 21:23063124-23063146 TGTTAAATGAATAAAATTTAGGG + Intergenic
1179697625 21:43132994-43133016 TTAAAAGCAAATAAAATTTCAGG - Intergenic
1180135337 21:45858655-45858677 TGGAAGGAAAATAAAATCTCAGG - Intronic
1180849561 22:19008405-19008427 TAGCAAGTGAAAAAAATTTCAGG + Intergenic
1180856647 22:19050808-19050830 CGGAAAATGATTAAAATTTTAGG + Intronic
1181664797 22:24386556-24386578 TAGCAAGTGAAAAAATTTTCAGG + Intronic
1182391722 22:30002939-30002961 TGGAAAGTGTATCAAGTTTCAGG + Exonic
1182852140 22:33484406-33484428 TGGAAAGAGAATAATGTTTCTGG + Intronic
949640645 3:6032179-6032201 TACAAAGAGAATAAAATATCTGG - Intergenic
949664753 3:6324306-6324328 TGAAAAGTGAATAATATTTCTGG - Intergenic
950201285 3:11046197-11046219 CGGCAAGAGAAAAAAATTTCTGG - Intergenic
950274436 3:11646663-11646685 TAGAAAATGAATAAAATATTTGG + Intronic
951678648 3:25271438-25271460 AGGAACGTGACTAAATTTTCTGG - Intronic
952053518 3:29415485-29415507 TAGACAGTGAAGAGAATTTCAGG + Intronic
952119180 3:30220890-30220912 TTGAAAGTTAAAAATATTTCTGG - Intergenic
952910840 3:38184115-38184137 GGGACAGTGAAAAAAACTTCTGG - Intronic
953189221 3:40668230-40668252 TGGAAAGTGAATGCAGTTCCTGG - Intergenic
954669966 3:52285233-52285255 TGAAAAGAAAATAAAATTTTAGG + Intronic
954835703 3:53465790-53465812 AGGAATGTGAAGAAACTTTCTGG - Intergenic
955704517 3:61714417-61714439 TGGAATGTGAATACAATGGCTGG + Intronic
955877584 3:63509006-63509028 TGGAAAGAACATAAAACTTCTGG + Intronic
955948389 3:64217595-64217617 TGGAAAGAGAATCAACTTCCAGG + Intronic
956538263 3:70304265-70304287 TGGAAATTAAATAAAATTTCTGG - Intergenic
956742406 3:72285667-72285689 TGGCAAGTGAAGAAAGTTGCAGG + Intergenic
956908951 3:73796953-73796975 TTGAAAGTAAATAATATTTTAGG + Intergenic
957108870 3:75927041-75927063 TTGAGTGTGAATAAAACTTCAGG + Intronic
957178528 3:76845530-76845552 TGGAATGTGTATTGAATTTCAGG + Intronic
957255435 3:77830218-77830240 TGTAAGTTGAATAAAAATTCAGG - Intergenic
957297517 3:78352118-78352140 GAGAAAGAAAATAAAATTTCAGG - Intergenic
957318987 3:78605053-78605075 TGGAAAGTGAATGGAAATTTTGG - Intronic
957517242 3:81271329-81271351 GTGAAAGAAAATAAAATTTCAGG - Intergenic
957595648 3:82261960-82261982 TGGAAGGTGGATAAAAGTTATGG + Intergenic
957733956 3:84181620-84181642 TGCAAAGAGAATAAAATCTCTGG + Intergenic
957875230 3:86136854-86136876 GGGATAGTCAATAGAATTTCTGG + Intergenic
958142488 3:89579879-89579901 GGGAAGTGGAATAAAATTTCAGG + Intergenic
958849149 3:99302825-99302847 TGGAAAGTGAAAAAAAAGGCAGG + Intergenic
959107301 3:102079251-102079273 TTGAAAGTAAATGTAATTTCCGG + Intergenic
959357153 3:105346302-105346324 TGCCAAGGCAATAAAATTTCTGG + Intergenic
960023372 3:112980888-112980910 TAAAATTTGAATAAAATTTCAGG - Intergenic
960506973 3:118505583-118505605 TGGAGAGAGGAAAAAATTTCAGG - Intergenic
962512759 3:136118632-136118654 TTCAAAGAGAATAAAATTCCTGG + Intronic
963351861 3:144161483-144161505 TGTATAGTGAAAAAAATCTCTGG - Intergenic
963444632 3:145388386-145388408 TAGAAAGTGACTAAAATGTATGG + Intergenic
963631108 3:147731002-147731024 TGTAAACTAAATGAAATTTCAGG - Intergenic
964487424 3:157200175-157200197 TGAAAAGAGAATAAAAATTGGGG - Intergenic
965881268 3:173391401-173391423 GGGAAAATGAAAATAATTTCTGG + Intergenic
965954557 3:174352921-174352943 TAAAAAGTAAATAAAATTTCTGG - Intergenic
966186784 3:177234479-177234501 AGGAATGTAATTAAAATTTCAGG - Intergenic
966750087 3:183313650-183313672 TGGAAAGAAAATAAACTTTTTGG + Intronic
967515433 3:190363127-190363149 TGGAAACTAAAGAAAAATTCTGG - Intronic
967563139 3:190940992-190941014 TTAAAAATGAATAAAAATTCTGG - Intergenic
970219189 4:13792330-13792352 TCAAATTTGAATAAAATTTCAGG + Intergenic
970630354 4:17936278-17936300 TGAAAAGTGGATAAAAGTTTAGG - Intronic
970634006 4:17987242-17987264 TGGAAAGTGAGTGAATTTTATGG - Intronic
970975971 4:22043343-22043365 TGGAAAGTGATTAAACATTGGGG + Intergenic
970992277 4:22226081-22226103 TGGAAAATGAAATGAATTTCTGG - Intergenic
971924061 4:32983692-32983714 TGGAAAGTGAATAAAAGGTTTGG + Intergenic
972493497 4:39610753-39610775 GGGGAAGAGAATAAAATTTTAGG + Intronic
974284457 4:59846201-59846223 TTCAAAGAGAATAAAATATCTGG + Intergenic
974831303 4:67192953-67192975 TGGAAAGGCATTAAAATTGCTGG - Intergenic
975571200 4:75819555-75819577 TGGAAAACTCATAAAATTTCAGG + Intergenic
975936828 4:79591664-79591686 GGGAAAAAGAAGAAAATTTCTGG - Intergenic
976400395 4:84600722-84600744 TGGAAAGAGAATAAAGTTGAAGG - Intronic
976814931 4:89137456-89137478 TTGAATTTGAATAAAATTTACGG - Intergenic
976852511 4:89564146-89564168 TGGAAAGGGAATATAAATTTAGG + Intergenic
976947606 4:90789946-90789968 TTGAGAGCAAATAAAATTTCAGG - Intronic
977213770 4:94253604-94253626 TGGAAAGATAGAAAAATTTCTGG + Intronic
977740283 4:100472370-100472392 TTAAAAGTGAATAAAATATTAGG + Intronic
977750258 4:100601367-100601389 TGGTAGCTTAATAAAATTTCAGG + Intronic
977966729 4:103159328-103159350 TGGAAAAGAAATAAAATTTAGGG + Intronic
978007517 4:103635872-103635894 TGGAAAGAGAATTGAAATTCAGG - Intronic
979001117 4:115221047-115221069 AAGAAAGAGAAGAAAATTTCAGG - Intergenic
979407028 4:120325874-120325896 AGGACAGAGAATAATATTTCGGG - Intergenic
979410785 4:120376380-120376402 TGGAAAGTTGATCAAATATCTGG - Intergenic
979829934 4:125286456-125286478 TGAAAAGTGAATAATATGGCCGG - Intergenic
980188058 4:129487843-129487865 TGGAAATTTAATTAAATTTGAGG + Intergenic
980537838 4:134152399-134152421 TTGAAAATTAATAAAATTTAAGG + Intergenic
980639811 4:135563064-135563086 ATGAAAGTGAATAAAACATCTGG + Intergenic
980838661 4:138229794-138229816 TCCAAAGTGAGTAAAATTTGTGG + Intronic
981118886 4:141025064-141025086 TAAAAAGAAAATAAAATTTCAGG - Intronic
981243381 4:142505870-142505892 TGGAAAATAAATACAATATCTGG - Intronic
981657506 4:147128397-147128419 GGGAAAATATATAAAATTTCTGG - Intergenic
982238412 4:153273883-153273905 AGGGGAGTGAATAGAATTTCAGG + Intronic
982403325 4:154992859-154992881 TGTTAAGTAAATAAAATTCCTGG + Intergenic
982474478 4:155833607-155833629 TGGAATATTACTAAAATTTCTGG - Intronic
982725338 4:158900656-158900678 TGGAAAGTGAAAAAAAGTAGGGG - Intronic
983194161 4:164786616-164786638 TGAAGTGTGAATAAATTTTCTGG - Intergenic
983820087 4:172182164-172182186 TACAAAGGGAATAAAATATCTGG + Intronic
984274214 4:177589931-177589953 TGGAAAGTGTAGTAAATTTGAGG + Intergenic
985402413 4:189605977-189605999 TGGGAAGGGAATAAAAACTCGGG + Intergenic
985433489 4:189904639-189904661 AAGAAAGTGAATGAAATTTTAGG + Intergenic
986065962 5:4234188-4234210 TGGCAAGTTAAAAAAAGTTCTGG - Intergenic
986604802 5:9511057-9511079 TGGAAAATTCAGAAAATTTCTGG - Intronic
987013212 5:13789332-13789354 CACAAAGTGAATAAAATTTGTGG + Intronic
987141859 5:14954624-14954646 TGGCAATTGACTAAAATTTAGGG + Intergenic
987163380 5:15168684-15168706 TGAAAAATGACTAAAAGTTCTGG - Intergenic
987754385 5:22082072-22082094 TGGAAAAAGTATAAAATTTGTGG - Intronic
987865877 5:23537591-23537613 TGGAAACTGACTATAATTCCAGG + Intergenic
987931287 5:24402199-24402221 TGGAAATGAAATAAAATTTGAGG - Intergenic
988052143 5:26044217-26044239 TGGAAAATACAAAAAATTTCTGG + Intergenic
988147246 5:27326293-27326315 TGGAATGTGATTAAAATTCCTGG + Intergenic
988226578 5:28419941-28419963 AAGAATGTGAATAAAATTCCTGG - Intergenic
988322582 5:29718346-29718368 TGGTAAGTGAATATATTTACGGG - Intergenic
988582782 5:32482733-32482755 TGGAAAGAGGAAAAAAGTTCTGG - Intergenic
989370213 5:40698586-40698608 TGAAAAGTGAACTAAAGTTCAGG + Intergenic
990129410 5:52562475-52562497 TTAAAAGTAAATAAAATTTCTGG + Intergenic
990680864 5:58242704-58242726 TGGAAGGTGAAGAAAATAACAGG + Intergenic
991729288 5:69568470-69568492 AGGAAAGAAAAAAAAATTTCAGG - Intronic
992259138 5:74952657-74952679 TGGAAATCAAATAAAAATTCAGG + Intergenic
992816413 5:80444839-80444861 TAGAGACTGAATAAAATTTAGGG - Intronic
993323870 5:86510144-86510166 TTGAAAGAGAATGGAATTTCAGG + Intergenic
993471686 5:88314238-88314260 TGTAAATTGTATAAAATGTCAGG - Intergenic
994058439 5:95446556-95446578 TTGAAAGTGAATGAAATCTATGG - Exonic
994673806 5:102795882-102795904 TGGAAATTGTAAAACATTTCAGG - Intronic
994968595 5:106706364-106706386 TGTAAAATGAATAAAAGTTATGG - Intergenic
995367587 5:111381043-111381065 GAGAAGGTGAATAAAGTTTCTGG - Intronic
996414155 5:123191603-123191625 TGACAAGTGAATAACATTTCTGG - Exonic
996889917 5:128406260-128406282 TGGAAAAGGAATTAAATTTGTGG - Intronic
996898367 5:128513558-128513580 TCAAAAGAGAATAAAATATCAGG + Intronic
996904846 5:128586850-128586872 TGGAAGATGAATAAAATTGAAGG - Intronic
998760777 5:145429519-145429541 TGGAAAGAGATTGATATTTCAGG + Intergenic
999238080 5:150111794-150111816 TGAAAATAAAATAAAATTTCAGG + Intronic
999655608 5:153807729-153807751 TGCAAATTGAATAAAATCTCAGG + Intronic
999663006 5:153885049-153885071 TGGTAAATTAAGAAAATTTCTGG - Intergenic
999679248 5:154040053-154040075 TGGAAAATGCATAGAATTTGGGG + Intronic
1000307850 5:160012208-160012230 TAGAAAATTAATATAATTTCAGG - Intronic
1000560730 5:162785626-162785648 TTAAAAATGAATATAATTTCAGG + Intergenic
1001309603 5:170601572-170601594 AGGAAATTGAATGAAATTTGAGG + Intronic
1001918040 5:175577938-175577960 TGAAAAGAAAAGAAAATTTCAGG - Intergenic
1002849848 6:983992-984014 TGGAAAGAGAATGAGATTTCTGG + Intergenic
1002857324 6:1049897-1049919 TGAAAAGGGAAAAAAAGTTCAGG + Intergenic
1006051472 6:31348177-31348199 TGAAAAGAAAATAAAATTTCAGG + Intronic
1006794818 6:36725115-36725137 TGAAAAGAGGATAAAACTTCTGG - Intronic
1007905902 6:45460494-45460516 TAGAAAGTGAACACACTTTCAGG + Intronic
1008054692 6:46934333-46934355 GGGAAAGTCAATAAAAGATCTGG - Intronic
1008835311 6:55820371-55820393 TGAAAAGAGAAAAAATTTTCTGG - Intronic
1008859856 6:56135500-56135522 TTGAAAGAGAATCAACTTTCTGG + Intronic
1009300043 6:62006951-62006973 CTGAAAGTTAAAAAAATTTCAGG + Intronic
1009598494 6:65767336-65767358 TGGATAGTAAATAATTTTTCAGG + Intergenic
1010111227 6:72235867-72235889 GGAAAATTGAATAAAATTTAGGG + Intronic
1010343073 6:74780161-74780183 TGGAAAGTGGATAAGATGGCTGG + Intergenic
1010446227 6:75951538-75951560 TGGAAAGTGAATAAAATTTCTGG - Intronic
1010457252 6:76071491-76071513 TGGAGGGAGAAAAAAATTTCTGG - Intronic
1010458847 6:76089964-76089986 TGAAAATTTAGTAAAATTTCAGG - Intergenic
1011048446 6:83114546-83114568 AGGAAAGTCAATAAATTTTTTGG - Intronic
1011724093 6:90190750-90190772 TGGGAAGTGAATACAATATTTGG - Intronic
1012488949 6:99757664-99757686 TGGAAACAGAATTAAATCTCTGG + Intergenic
1013729335 6:113145124-113145146 TGGCAAGTGAAAGAAATTTCTGG + Intergenic
1016236773 6:141877633-141877655 GGAAAAGAAAATAAAATTTCAGG - Intergenic
1017068063 6:150548402-150548424 TAAAAAGAAAATAAAATTTCAGG + Intergenic
1017802153 6:157906981-157907003 TGGAAACTTGATAAAATTGCAGG + Intronic
1017956730 6:159184713-159184735 GGGAAAAGGAATAAATTTTCAGG + Intronic
1019010155 6:168838532-168838554 TGTAAAGTGAAATAAAATTCTGG + Intergenic
1019582820 7:1775886-1775908 TGGAAAAGGAATAGAATCTCAGG - Intergenic
1020539359 7:9440782-9440804 TTCAAAGAGAATAAAATATCTGG + Intergenic
1022603646 7:31786484-31786506 TAGAAGTTGAATAAATTTTCAGG + Intronic
1022644826 7:32220316-32220338 TGAAAATTGAATAAAAATTATGG - Intronic
1023060247 7:36319840-36319862 TGGCAAGAGAACAAAATATCTGG + Intergenic
1024179549 7:46877181-46877203 TGGAAAGTGAATGAATTATGGGG + Intergenic
1024369647 7:48566197-48566219 TGGAAATTAAATAAAATGTTTGG - Intronic
1024738493 7:52331143-52331165 TTGAAAGAGAATAAAATACCTGG + Intergenic
1025106152 7:56173950-56173972 TGGAAAGTGCTAAAAATTTAAGG - Intergenic
1025576502 7:62649828-62649850 TTGAAAATGGATAAAACTTCAGG - Intergenic
1026316324 7:69230849-69230871 TGGAAAGTGCTAAAAATTTAAGG - Intergenic
1027641521 7:80739248-80739270 TAGAAATAGTATAAAATTTCTGG + Intergenic
1027753160 7:82177536-82177558 TGGAAAGTTAAGATAATATCTGG + Intronic
1027758981 7:82253257-82253279 TGGAAAATGAATCAAATCACAGG + Intronic
1027933936 7:84578239-84578261 TGGAAATAGCATAAAATATCAGG + Intergenic
1029929241 7:104353131-104353153 TATAAAATGAATAAAATGTCTGG - Intronic
1030382121 7:108824207-108824229 TGGAAAGTCCTTGAAATTTCAGG - Intergenic
1030517318 7:110554123-110554145 AAGAAAGTGAATACTATTTCAGG + Intergenic
1030543503 7:110863227-110863249 TGTAAAGTGAGTAAAATGTAAGG - Intronic
1030841743 7:114361886-114361908 TGTAATGTGAATAATACTTCTGG + Intronic
1031189491 7:118529211-118529233 TGAAAAATAAATACAATTTCAGG - Intergenic
1031249584 7:119362776-119362798 GGTAAAGTGAATAAAATATTAGG - Intergenic
1031249593 7:119362872-119362894 GGTAAAGTGAATAAAATATTAGG - Intergenic
1031772324 7:125860001-125860023 TGGAAAATGAATTCAATTTGTGG - Intergenic
1032905168 7:136356384-136356406 TTAAAAATGAATAAAATTTATGG + Intergenic
1033614598 7:143002020-143002042 TGTAAACTAATTAAAATTTCTGG - Intergenic
1034512007 7:151543270-151543292 TGGAAAGAGAATCAATTTCCAGG + Intergenic
1034831458 7:154311681-154311703 AGGACAGAGAATAAACTTTCTGG - Intronic
1035240725 7:157527562-157527584 TAGAAAAAGAATAAAACTTCCGG + Intergenic
1037269938 8:17115491-17115513 TGGAAAATGAAAAAAATTGATGG + Intronic
1037698055 8:21244982-21245004 TGAAAACTAAATAAAATTTACGG - Intergenic
1037925107 8:22838365-22838387 TGGAAAGGGAAAGAAATTTTTGG + Intronic
1038131941 8:24742132-24742154 TGGAAAGAAAATAAAGTTGCTGG + Intergenic
1038411538 8:27363059-27363081 TGGAAAATGACTAAAAACTCAGG + Intronic
1038720625 8:30032347-30032369 AGGAAATTTAAGAAAATTTCTGG - Intergenic
1038817601 8:30921161-30921183 TGGAAAGTTGTTCAAATTTCTGG - Intergenic
1039040660 8:33404981-33405003 TGGAAAGTGAATACTTTTGCAGG + Intronic
1039370960 8:36983342-36983364 GAGAAAGGGAATAAAATTCCAGG + Intergenic
1039916194 8:41862057-41862079 TGGAACTGGAACAAAATTTCGGG + Intronic
1041954115 8:63538158-63538180 TGGAAAAGGAATTAAATTTGAGG - Intergenic
1041988924 8:63961174-63961196 TGGAAAGGGAATGGAAGTTCTGG + Intergenic
1044975575 8:97662019-97662041 TGGAAAATTAATAAAATCTCAGG - Intronic
1045026865 8:98095785-98095807 TGGAAATTTATAAAAATTTCTGG + Intergenic
1045707984 8:104948884-104948906 AGTAAATAGAATAAAATTTCAGG + Intronic
1045831503 8:106467091-106467113 TTGGAAGTGAAAAAAATGTCAGG - Intronic
1048583643 8:135751992-135752014 TGGAAAGATATTCAAATTTCTGG - Intergenic
1048606385 8:135972889-135972911 TGGAAAGGGATTGACATTTCAGG - Intergenic
1048702625 8:137110045-137110067 TAGAAAGAGAATAAAATTATGGG + Intergenic
1049975702 9:859543-859565 TGGAAAGTGAAGACACCTTCAGG - Intronic
1050222916 9:3415905-3415927 TAGGTAGTGAATAAAACTTCAGG - Intronic
1051094661 9:13452796-13452818 TGGACAATAATTAAAATTTCTGG - Intergenic
1051104593 9:13565121-13565143 TGGAAAATAAAGAAAAATTCTGG - Intergenic
1051112782 9:13658217-13658239 TATGAAGTGAATAAAATTTTAGG - Intergenic
1051207718 9:14706090-14706112 TTGTAAGTAAAAAAAATTTCAGG + Intergenic
1052016416 9:23473604-23473626 GGGAATGTAAAGAAAATTTCAGG - Intergenic
1052167244 9:25347280-25347302 TGGAAAGTGAAAAAGTCTTCAGG - Intergenic
1054737979 9:68775165-68775187 TGGAAAGGGCATTAAATTTGTGG - Intronic
1055307365 9:74943637-74943659 TGGACACTAAATAACATTTCAGG - Intergenic
1055565234 9:77561670-77561692 TGGAATGACAAAAAAATTTCTGG + Intronic
1055611293 9:78027922-78027944 TAGGAACTGAAAAAAATTTCAGG + Intronic
1056301625 9:85248130-85248152 TGGAAAGAGACAAAACTTTCTGG + Intergenic
1057243609 9:93435068-93435090 TGGAAAGAAAAGAAAATTTCAGG - Intergenic
1058399795 9:104601968-104601990 TAGCAAGTATATAAAATTTCCGG - Intergenic
1058763468 9:108159463-108159485 GGGAAATAGAATAAAATTTGTGG - Intergenic
1059186404 9:112276395-112276417 TGCTAAATAAATAAAATTTCAGG + Intronic
1059267465 9:113049027-113049049 TTGTAAGTAACTAAAATTTCAGG + Intronic
1059873674 9:118607347-118607369 TGAAAACTGAATAAGTTTTCTGG - Intergenic
1060577154 9:124706814-124706836 TGGAAAGGGAACAAAATTGTTGG - Intronic
1186734632 X:12448557-12448579 TGGAAAGAAAATAACATTCCTGG + Intronic
1187067673 X:15855759-15855781 TGCAAAATGAATACAATTTAAGG - Intergenic
1187077103 X:15946485-15946507 TGCAATGTGAATAACACTTCTGG + Intergenic
1187134798 X:16537038-16537060 AGGAAAGTAAAGAAAATCTCTGG - Intergenic
1187179499 X:16930221-16930243 TAAAAATTGAATAAAATTTGTGG + Intergenic
1187255485 X:17637986-17638008 GGGAATGTGACTCAAATTTCAGG + Intronic
1187666826 X:21622019-21622041 TAGCAAGTGAATAAACTTTTTGG - Intronic
1187938218 X:24356459-24356481 TGGATAGTGAAAAAGATTTTTGG + Intergenic
1188756201 X:33967505-33967527 TGAAAAGATAATAAAATTTGTGG + Intergenic
1188863803 X:35289510-35289532 TGAAAAGTGATTAAGATTTATGG + Intergenic
1189079756 X:37958578-37958600 TGAAAAGAAAATAAAATTTGGGG - Intronic
1189284679 X:39843243-39843265 TGGAAAGTAAATGATGTTTCCGG + Intergenic
1189713192 X:43837076-43837098 AGGCAAGTGAATATAATCTCTGG + Intronic
1190543888 X:51504984-51505006 TGGAAAATGAATCAGACTTCTGG - Intergenic
1190569456 X:51766768-51766790 TGGTAATTGAATTAAATGTCGGG + Intergenic
1190587300 X:51959303-51959325 TGGAAAACAAATAAAATTGCAGG - Intergenic
1193151888 X:78134055-78134077 CAGAAAGGGAATAAATTTTCTGG - Intronic
1193416492 X:81230514-81230536 TGCAAAGAAAATAACATTTCAGG + Intronic
1194598272 X:95887228-95887250 AGGAAAGAAAATAAAATCTCAGG - Intergenic
1195430806 X:104787208-104787230 TGGATATGGAATAAAATGTCAGG + Intronic
1196282907 X:113844786-113844808 TGTAAAGAAAATGAAATTTCAGG + Intergenic
1196340866 X:114595522-114595544 TGGAAATAGAATGAAATTTTAGG - Intronic
1198119606 X:133579115-133579137 TGGAAAGGGAAGAAAATTGTAGG - Intronic
1200425530 Y:3016580-3016602 TGCAAAGGGAATAAAATACCTGG - Intergenic
1200611702 Y:5332926-5332948 AGGAAAGTGAAATAAATTTTTGG + Intronic
1201511886 Y:14773325-14773347 TGCAAAGGGAATAAAATACCTGG + Intronic
1201691144 Y:16766470-16766492 TTCAAAGTGAATAAAATACCTGG + Intergenic