ID: 1010451297

View in Genome Browser
Species Human (GRCh38)
Location 6:76006122-76006144
Sequence TTTTTCAAAAAGACCTAGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 358
Summary {0: 1, 1: 0, 2: 2, 3: 30, 4: 325}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1010451297_1010451300 3 Left 1010451297 6:76006122-76006144 CCCACCTAGGTCTTTTTGAAAAA 0: 1
1: 0
2: 2
3: 30
4: 325
Right 1010451300 6:76006148-76006170 CTTTTTGTCAAAAAAGTTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1010451297 Original CRISPR TTTTTCAAAAAGACCTAGGT GGG (reversed) Intronic
902104460 1:14022805-14022827 TTCTTGAAAGAGAGCTAGGTGGG + Intergenic
902111943 1:14087041-14087063 TTTTTCAAAAACAGCTTGCTGGG + Intergenic
904196779 1:28791644-28791666 TTTTTAAAAAAGCCATAGCTGGG + Intergenic
905947975 1:41919714-41919736 TTTTTCAAAAAAATTTAGGCTGG - Intronic
906257914 1:44364762-44364784 TTTTACAAATTGACCTAGCTTGG - Intergenic
908135652 1:61129220-61129242 TTTTTCTAAAACACATAAGTAGG - Intronic
908346150 1:63235318-63235340 TTTTTTAAAAAGAACAAAGTTGG - Intergenic
908368251 1:63450155-63450177 TTTTTAAAACAGACCAAAGTTGG + Intronic
908545552 1:65158806-65158828 TTTTTAAAAAAAATCTAGTTTGG - Intronic
909280516 1:73746111-73746133 TTTTTTAATAGGAACTAGGTTGG + Intergenic
909758057 1:79252431-79252453 TTATTAAAAAAGACCCAGGGAGG - Intergenic
910260108 1:85285774-85285796 TTTTTTAAATTGATCTAGGTGGG - Intergenic
911301791 1:96183581-96183603 TTATTTAAAAAGAATTAGGTTGG + Intergenic
912341718 1:108922801-108922823 TTTTTCAAAGAAAACTAGGGAGG - Intronic
913716881 1:121544346-121544368 TTTTTTAAAAAGACCAAAGCAGG + Intergenic
914384013 1:147149999-147150021 TTTTTTAAAAAGAACAAAGTTGG + Intergenic
917350135 1:174068715-174068737 TTTTTCAAAAACATCTTGGAAGG + Intergenic
918624677 1:186643854-186643876 TATTTTTAAAAGACCTGGGTAGG + Intergenic
920219938 1:204389516-204389538 TTTTTCCCCAAGTCCTAGGTTGG - Intergenic
921004057 1:211075570-211075592 TTTTTCAACTACACCTGGGTGGG - Intronic
923903601 1:238357135-238357157 TGTTTCAAAAAGAGCAAGTTGGG + Intergenic
924076890 1:240348590-240348612 CTTTTCAAAATGACTTAGGTTGG + Intronic
1063111468 10:3041646-3041668 TTTTACAGAAATACCTAGGAGGG - Intergenic
1065848367 10:29765239-29765261 TTTTGCAAAAAGACTGAGATGGG - Intergenic
1065923001 10:30409773-30409795 GTCTTAAAAAAGACCTAGCTGGG - Intergenic
1067581145 10:47446833-47446855 TTTTTCAAAAAGAAATATGTAGG + Intergenic
1068280233 10:54858712-54858734 TTTATAAAACAAACCTAGGTAGG - Intronic
1069366164 10:67696055-67696077 TTTTCCAAAAAGAGCTTTGTGGG + Exonic
1070269930 10:74943809-74943831 TTTTTCCAAAAGAAATTGGTAGG + Intronic
1070645021 10:78195772-78195794 TTTTTCAAACAAACCTAGTAAGG + Intergenic
1071699649 10:87916535-87916557 TTTTTAAAAAAGTATTAGGTAGG + Intronic
1072697839 10:97617255-97617277 ATTCTCAAAATGACCCAGGTAGG + Exonic
1073274290 10:102295715-102295737 TTTTTTTAAAAGACTTATGTGGG + Intronic
1073395984 10:103217945-103217967 TATTTCAGTAGGACCTAGGTAGG + Intergenic
1073796907 10:106998424-106998446 TTTTGCAAGGAGACCTAGGTAGG + Intronic
1073935808 10:108630427-108630449 TTTATCAAAGAGATCTGGGTTGG + Intergenic
1074413898 10:113250371-113250393 TTTTGTAAAAAGTGCTAGGTTGG + Intergenic
1076293324 10:129364725-129364747 TTTTTCAAAAAGTCCAAGGGGGG - Intergenic
1080427055 11:32165137-32165159 TTTTTAAAAAAGAAGTATGTTGG + Intergenic
1081544655 11:44061769-44061791 TTTTTTAAAAAGAGCTATATCGG - Intergenic
1081955947 11:47093214-47093236 GTTTTAAAAAATACCTAAGTTGG + Intronic
1082048659 11:47752125-47752147 TTATTTAAAAAGACAGAGGTTGG + Intronic
1082564123 11:54655494-54655516 TTGATTAAAAAAACCTAGGTAGG + Intergenic
1082913654 11:58406664-58406686 TTTTTCTAAAATACTGAGGTGGG - Intergenic
1083889928 11:65590670-65590692 TTTGTCAAAAAGATCTCTGTAGG - Intronic
1084967883 11:72753804-72753826 GTCTTCAAAATGACCTAGGGAGG + Intronic
1085144988 11:74187192-74187214 TTTTTAAAAAAGAACAAAGTTGG - Intronic
1085617046 11:78008405-78008427 TATTTTAAAAAGACCTGGCTGGG - Intergenic
1086180723 11:83948279-83948301 TTTTTAAAGAAAACCTAGGATGG + Intronic
1087092077 11:94284043-94284065 TATTCCAAAAAGACCTGGCTGGG + Intergenic
1087092099 11:94284185-94284207 TATTCCAAAAAGACCTGGCTGGG + Intergenic
1087647211 11:100822069-100822091 TCCTTCCATAAGACCTAGGTAGG + Intronic
1087756838 11:102063372-102063394 TGTTTCCAAAATACATAGGTGGG - Intronic
1090824184 11:130372270-130372292 TTTTGTAAAAAGATCTGGGTAGG - Intergenic
1091058620 11:132441466-132441488 TTTTTAAAAAAGTCCTTGGTGGG - Intronic
1091835813 12:3584873-3584895 CTTTTTAAAAAAACTTAGGTTGG + Intronic
1092701334 12:11234576-11234598 GTTTTTAAAAATAACTAGGTAGG - Intergenic
1093129877 12:15378201-15378223 CTTTTCAAAAAAACCAAGTTTGG - Intronic
1094333353 12:29320642-29320664 TGTAGCTAAAAGACCTAGGTTGG + Intronic
1094423694 12:30297801-30297823 TTTTTAAAAAACACCTAATTAGG + Intergenic
1095265730 12:40155036-40155058 ATTTTCAAAAAGAACAAGGCAGG - Intergenic
1095828796 12:46560482-46560504 TTTTTCAGAAAATCCTAGGCTGG - Intergenic
1096474479 12:51899802-51899824 TGTTTAAAAAATCCCTAGGTTGG + Intergenic
1097348603 12:58522708-58522730 ATTTTCAAAAAGATCCAGTTTGG - Intergenic
1097698423 12:62796907-62796929 TTCATCAAAAAGACCAAGGCAGG - Intronic
1099662579 12:85583479-85583501 ATACTCAAAAAGACCTAAGTTGG + Intergenic
1099824163 12:87753472-87753494 TTTTTAAAAAAGACATATTTAGG + Intergenic
1100322270 12:93507021-93507043 TGTTTAAAAAAGACATTGGTTGG - Exonic
1100377756 12:94033063-94033085 TTTTACAACTAGACCTGGGTGGG - Intergenic
1100485648 12:95023901-95023923 CTTTTCAAAAAGACTGTGGTGGG + Intronic
1102199862 12:111049788-111049810 TCTCTCAAAAAGACCTTGCTGGG - Intronic
1102467522 12:113138534-113138556 TGTTTCATAAAGACTTAAGTGGG + Intergenic
1103631494 12:122265318-122265340 GGTGTCAAAAAGTCCTAGGTTGG - Intronic
1104680289 12:130746481-130746503 TTTTTCCCACAGACCGAGGTGGG + Intergenic
1105339691 13:19509648-19509670 ATTTTGAAAAATACCTATGTGGG - Intronic
1107303783 13:38995689-38995711 TTTTTAAAAAATACCCATGTAGG + Intergenic
1108106578 13:47017108-47017130 TGTTTCAAAAAGACCATGTTGGG + Intergenic
1109554185 13:63949565-63949587 TTTTTCAAAAAGATTAAGGTAGG + Intergenic
1109913259 13:68944673-68944695 TTTTTTAAAAAGAGCTAGCTGGG + Intergenic
1110603776 13:77407647-77407669 CATTTAGAAAAGACCTAGGTAGG + Intergenic
1111402002 13:87749970-87749992 TTTTTTAAAGATAGCTAGGTAGG - Intergenic
1111751839 13:92342483-92342505 CTTATCAAAAAGACCTGGGAAGG + Intronic
1112282067 13:98071890-98071912 TTTTTTAAAAAGGCCAAGGCGGG - Intergenic
1112351391 13:98637710-98637732 TTTTTCCAAAAAACATAGGAAGG - Intergenic
1112665271 13:101564191-101564213 TTTTTTAAAAAGAACAAAGTTGG + Intronic
1113199780 13:107854569-107854591 CTTTTTAAAAAGACCTATTTGGG + Intronic
1113397424 13:109961582-109961604 GTTTTAAAAAATACCTAAGTTGG + Intergenic
1113863871 13:113508842-113508864 TTTTTCACTAAGAACTAGGTGGG + Intronic
1115376452 14:32682179-32682201 TTTTTGAAAGAGGGCTAGGTCGG + Intronic
1116647878 14:47552712-47552734 TTTTTTAAAAAGCCATTGGTGGG - Intronic
1116850178 14:49900953-49900975 TTTATGAATAAGTCCTAGGTTGG + Intergenic
1117673427 14:58131429-58131451 TTTTTGAAAAAGAATTAAGTAGG - Intronic
1120532463 14:85648653-85648675 TTTTCCCTAAATACCTAGGTAGG + Exonic
1120668067 14:87330892-87330914 TATTGGAAAAAGACATAGGTAGG - Intergenic
1120742066 14:88119213-88119235 TTTTTTAAAAAAAACTAGCTGGG + Intergenic
1120846861 14:89133848-89133870 TTTTTAAAAAAGATCTAGGAGGG - Intronic
1121036838 14:90712819-90712841 ATTTTTAAAAAGAACTAAGTTGG + Intronic
1122233450 14:100318773-100318795 TTTTTCAATGAGACCCAGGCTGG + Intergenic
1123798407 15:23797130-23797152 TTTTTGAAAAAGACCTCTGTGGG + Intergenic
1124428622 15:29586489-29586511 TTTTTCTAAAAGACCAATGGAGG + Intergenic
1125029543 15:35062350-35062372 GTTCTCAAAAATACCCAGGTGGG - Intergenic
1125450831 15:39805394-39805416 TTTTTCAAAAAGTATTATGTGGG - Intronic
1126452244 15:48821006-48821028 ATTTTTAAAAAGAACAAGGTGGG - Intergenic
1126601203 15:50429532-50429554 CTTTTTAAAAATACCTATGTGGG + Intronic
1126721209 15:51582210-51582232 TTTTTCAAAAATATTAAGGTGGG - Intronic
1128996489 15:72300535-72300557 TTTTTGTAAAAAAGCTAGGTTGG + Intronic
1131727306 15:95240644-95240666 TTTTTTAAAAAGCTCTAGTTAGG + Intergenic
1134603835 16:15554501-15554523 TTTTTTAAATAGACCAAGCTGGG + Intronic
1135356319 16:21772058-21772080 TTTTTCAAAAATAGTTTGGTGGG + Intergenic
1136221422 16:28831638-28831660 TTTTTAAAACAGGCCGAGGTAGG + Intronic
1138844056 16:60543755-60543777 ATTTTCACAAAAATCTAGGTGGG - Intergenic
1138922505 16:61549033-61549055 CTTTTCAAAAATCCCAAGGTAGG + Intergenic
1139554568 16:67698797-67698819 TTTGGCAGAAAGACGTAGGTAGG + Intronic
1139821998 16:69727999-69728021 GTTTTAAAAAAGGGCTAGGTAGG + Intergenic
1139828351 16:69775776-69775798 TTTTTAAACAAGAACTAGGGAGG - Intronic
1140309475 16:73835234-73835256 TTTTTCTAAGAGACCTAGGATGG + Intergenic
1141403294 16:83769844-83769866 CATTTCAAAAAGGGCTAGGTAGG + Intronic
1141574462 16:84955180-84955202 TTTTTAAAAATGAGCCAGGTAGG + Intergenic
1141903836 16:87009726-87009748 TTTTTAAAAAAGTCCCAGGCCGG + Intergenic
1142584786 17:965271-965293 ATTTTCAAAAAGACAAAAGTGGG + Intronic
1143949640 17:10622373-10622395 TGTTTCAAATAGGCCTAAGTAGG + Intergenic
1145230024 17:21166884-21166906 TTTTTAAAAAAAACTTTGGTGGG + Intronic
1146508994 17:33429689-33429711 TTGTTCAAAACTACCTAGGCTGG - Intronic
1146560635 17:33866431-33866453 TTTTTCAAAAAAAAATATGTGGG - Intronic
1146985882 17:37217385-37217407 TACTTCAAAAACACCTAGCTAGG + Intronic
1149634192 17:58153350-58153372 TTTTTCAAACAGTCCTAGGCTGG + Intergenic
1150915870 17:69436383-69436405 TTTTACAAAAATACCTATATGGG + Intronic
1150999300 17:70355067-70355089 TTTTTTAAAGAGACTTAAGTGGG + Intergenic
1151226604 17:72652695-72652717 TGTTTCAAAGAGACCTGGCTTGG + Intronic
1151253507 17:72856453-72856475 TTTGTCAATGAGACCTAGCTGGG + Intronic
1151261831 17:72922041-72922063 GCTTTCAGACAGACCTAGGTTGG - Intronic
1151610010 17:75166780-75166802 TCTTTCAAAAAGACCTAAGACGG + Intronic
1154225108 18:12496431-12496453 CTTGTAAAAAAAACCTAGGTAGG + Intronic
1155574220 18:27227584-27227606 TTTTTCAAAGATACTTTGGTAGG + Intergenic
1155673153 18:28396520-28396542 TTTTTTAAAAAGGTATAGGTGGG - Intergenic
1157660475 18:49437747-49437769 TTTTTAAAAAAAATCTAAGTTGG - Intronic
1157930034 18:51811709-51811731 TTTTTAAAAGAGACAGAGGTTGG - Intergenic
1158027381 18:52916941-52916963 TTTTAAAAAAACACCTATGTCGG - Intronic
1158060076 18:53329899-53329921 TTTCTCAAATATACCTAGATAGG - Intronic
1158616393 18:58991681-58991703 TTTTTAAAAAAGAACAAGGTAGG + Intergenic
1159204491 18:65232672-65232694 GTTTTCAAAAAGATATAGTTTGG + Intergenic
1159240918 18:65742489-65742511 TTTTTAAAAAAGCACTATGTGGG + Intergenic
1159362880 18:67428035-67428057 TTTTTGAAAAAGACATATTTAGG - Intergenic
1159484539 18:69037882-69037904 TTTACCTCAAAGACCTAGGTGGG - Intronic
1160067997 18:75595495-75595517 TTTTTCAAAAATACCAATATCGG + Intergenic
1160329786 18:77980715-77980737 GTGGTCAAAAAGACCTGGGTGGG + Intergenic
1161099199 19:2412590-2412612 TTTCTCAAGAGGACCTGGGTTGG - Intronic
1161442668 19:4301241-4301263 TTTAATAAAAAGACCTTGGTTGG + Intronic
1165294877 19:34918533-34918555 TTTTTCAAAGATACTTTGGTGGG - Intergenic
1165782035 19:38440645-38440667 TTTTTCATAAGGACCAGGGTGGG + Intronic
1167039959 19:47018093-47018115 TTTTTAAAAAATAGCTGGGTGGG + Intergenic
1167394675 19:49220456-49220478 TTTTTTAAAATTAGCTAGGTGGG + Intergenic
1168034854 19:53711240-53711262 TGAATCCAAAAGACCTAGGTTGG - Intergenic
926507237 2:13732491-13732513 TTTTTCAAAGACAGCTTGGTGGG + Intergenic
926721017 2:15960149-15960171 TTTTTCATAAAGATCTTGATAGG - Intergenic
928258904 2:29749381-29749403 TGTTTGTAAAAGACATAGGTTGG - Intronic
928640580 2:33294490-33294512 TTTTTAAAAGAGACCTAGCCAGG - Intronic
928786929 2:34899206-34899228 TTTTTAAAAAATACATAGCTGGG - Intergenic
928830024 2:35470358-35470380 TTTTTAAAAAATACATAGCTAGG - Intergenic
928944854 2:36763010-36763032 TTTTTTAAAAAAAACTAGGAAGG + Intronic
932248781 2:70221307-70221329 TTTTTAAAAAAAAATTAGGTGGG + Intronic
932637912 2:73409031-73409053 TTTTTTAAAAATAATTAGGTGGG - Intronic
933391718 2:81677895-81677917 TTTTTTAAAAAGAACTTTGTGGG - Intergenic
933797564 2:85932250-85932272 TTTTTAAAAAAGACAAAGGTAGG - Intergenic
934540946 2:95174523-95174545 TTTTTCAAAAAGAAGGAGGCAGG - Intronic
935075068 2:99733597-99733619 TTTTTAAAAAATACCTGGATTGG + Intronic
935417801 2:102837179-102837201 TTTTTCAAATAGAATTGGGTTGG - Intronic
936040738 2:109147138-109147160 TTTGTCCAAAAGACAGAGGTTGG + Intronic
936490330 2:112964718-112964740 TTTTTGTAAAAGCCCTAGATGGG + Intergenic
938730740 2:134145077-134145099 ATTTTCCAAAAGACCAAGGTGGG - Intronic
939598982 2:144165006-144165028 TGTTTTAAAAAGACTTTGGTTGG + Intronic
939770860 2:146315899-146315921 TCTTTCAAAAAGCCCTTAGTGGG + Intergenic
942082135 2:172410328-172410350 TTTTTAAAAAACAACGAGGTTGG - Intergenic
943119798 2:183721533-183721555 TTTTTTAAAAAGAACAAAGTAGG + Intergenic
943750715 2:191506805-191506827 TTTTTTAAAAGGAGCTGGGTGGG + Intergenic
943814860 2:192239749-192239771 TCTTTCAAAAAAAACTAGGTAGG - Intergenic
944051311 2:195473168-195473190 TTATTCAAAAATACTTAGGATGG - Intergenic
945260516 2:207838738-207838760 TTTTTCCTAAATACCAAGGTGGG - Intronic
945997622 2:216451223-216451245 TTTTTCAAAACTGACTAGGTAGG - Intronic
946483336 2:220077351-220077373 GTTTTCACAAAGGCTTAGGTCGG + Intergenic
946668101 2:222072543-222072565 TTTTTAAAAAACACCTATGCTGG + Intergenic
1169958401 20:11131465-11131487 TTTTTGAAAAACAACTATGTAGG + Intergenic
1170258957 20:14380847-14380869 GTTTTGAAAAAGAACAAGGTTGG - Intronic
1172054904 20:32147548-32147570 TGTTTTAAAAAAAACTAGGTCGG + Intronic
1172259853 20:33553792-33553814 TTTTTCAAAAAACCCTAAGAGGG - Intronic
1172757201 20:37294084-37294106 ATTTTTAAAAAGACATAGGAAGG - Intronic
1173116694 20:40250294-40250316 TTTTTAAAAAAGAAGAAGGTTGG + Intergenic
1173124742 20:40326344-40326366 TTTTTCATAAAGATATATGTGGG - Intergenic
1174558542 20:51413456-51413478 TTTTTCAAAAAAACCTAAAGAGG + Intronic
1174648724 20:52106402-52106424 TGTTTCAAAAAGACCCAGCCAGG + Intronic
1175132170 20:56797521-56797543 TCTTTCAAAAAGACACAAGTCGG + Intergenic
1175839592 20:62018658-62018680 TTCCTCACAAAGACCTGGGTGGG - Intronic
1176734503 21:10532118-10532140 ATTTTGAAAAATACCTATGTGGG + Intronic
1177049699 21:16217579-16217601 TTTTTCATAGAGACATAGGAAGG - Intergenic
1180562242 22:16627589-16627611 ATTTTGAAAAATACCTATGTGGG + Intergenic
1181660161 22:24340841-24340863 TTTTTCAAAACTCCCTGGGTAGG + Intronic
1181869343 22:25885698-25885720 ATTTTCAAAAAGAGGTATGTGGG + Intronic
1182060920 22:27396646-27396668 TTACTTAAAAATACCTAGGTTGG + Intergenic
1182431759 22:30302982-30303004 TTTTTAAAAAAGAGATAGGCTGG + Intronic
1182976495 22:34627230-34627252 TTTTTGAATATGACCTAGTTTGG - Intergenic
1183123317 22:35749769-35749791 TTTTTCAAAAAGAACAAGGGTGG + Intronic
1183573503 22:38671965-38671987 TTTTTAAAAAAGGACTAGGCTGG + Intronic
950727920 3:14930287-14930309 GTCTTAAAAAAGAACTAGGTTGG - Intronic
951734158 3:25845019-25845041 TTTTTTTAAAAGAGCTAGATAGG - Intergenic
952200359 3:31120128-31120150 TGTTTCAAGAGGTCCTAGGTGGG + Intergenic
952552212 3:34492294-34492316 TTCTTCAAGAAAACCTAGGAGGG - Intergenic
953742619 3:45550464-45550486 TTTTTCAAAAACATGTAGCTTGG + Intergenic
953950794 3:47188422-47188444 TTTTTTTAAAAGCCCGAGGTGGG - Intergenic
955790211 3:62581518-62581540 TTTTTTAAAAAAACTTAGCTGGG + Intronic
956006631 3:64786257-64786279 ATTTTCAAAAAGAACAAAGTTGG + Intergenic
956386643 3:68726137-68726159 TTCTTTAAAAAGATCTATGTTGG - Intergenic
956695570 3:71916413-71916435 TTTTTAAAAAAGAACTAGGCTGG + Intergenic
956763133 3:72461196-72461218 GGATTCAAACAGACCTAGGTTGG + Intergenic
957581384 3:82077636-82077658 TTTTTCAAAAAGACATGAATAGG - Intergenic
960981064 3:123227206-123227228 TTTTTCCTAAAGCCTTAGGTTGG - Intronic
961397589 3:126606962-126606984 TTTTCCAAAAGGACCTTGGATGG + Intronic
961608626 3:128117999-128118021 GTTTTGAAAAAGAGCTATGTTGG - Intronic
962122745 3:132580041-132580063 TTTTGCAAAAAGACCCTTGTAGG - Intronic
962145741 3:132837708-132837730 TTTTTCAAAAAGTGCTAGCACGG + Intergenic
962503372 3:136018848-136018870 TTTCTCAAAAAGAACCGGGTAGG - Intronic
964490447 3:157230424-157230446 TTTTTCTAAAATATCTAGTTGGG - Intergenic
965780518 3:172281100-172281122 TTTTTGAAAAGGAGCTAAGTTGG - Intronic
970850119 4:20591491-20591513 TTTTTCAAAAAGACATTGTAGGG - Intronic
971260549 4:25052931-25052953 TTTTTCATAAAAACCTTAGTAGG - Intergenic
971557629 4:28034965-28034987 TTTTTCAAAAAAAATTTGGTGGG - Intergenic
971932458 4:33102510-33102532 TTTTTCTTAAAGACCTAGAAGGG - Intergenic
974434285 4:61837232-61837254 TCTTAGAATAAGACCTAGGTGGG - Intronic
974595246 4:64005461-64005483 TTTTCCAAAATGAACTAGCTAGG - Intergenic
975787892 4:77912752-77912774 TTTTTGAAAAAGAACAAAGTTGG + Intronic
976093666 4:81484120-81484142 TTGTTCAAAAATGCCTTGGTTGG - Intronic
976554452 4:86433698-86433720 TTTTTAAAGAAGGCCTAGGCTGG - Intronic
976691677 4:87874821-87874843 TGCTTCAAAATAACCTAGGTGGG + Intergenic
979015341 4:115424937-115424959 TTGTGCACAATGACCTAGGTGGG - Intergenic
979350842 4:119642913-119642935 TTTTTCAAAAGGACAGAGGCGGG + Intergenic
980563201 4:134503585-134503607 TATTCCAAAAAGACCTAAGATGG - Intergenic
980945236 4:139313301-139313323 TTTTTCAAAGAGAACTTGTTGGG + Intronic
981179773 4:141726983-141727005 TTTTTCAAAATGTCATAGTTGGG - Intronic
982475296 4:155843037-155843059 TTTTTCAGAAAGAATCAGGTGGG + Intronic
983271414 4:165566924-165566946 TTTTTCCCCAAAACCTAGGTTGG - Intergenic
983964436 4:173792368-173792390 TTTTGAAAAGAGACCTCGGTGGG + Intergenic
984056302 4:174933461-174933483 TTTTTTAAATAGAGCTTGGTAGG - Intronic
984332177 4:178337862-178337884 TTCTTAAAAAAGAGCTGGGTGGG - Intergenic
984422085 4:179536513-179536535 TTTCTCAAAAAGACTTAGCTTGG - Intergenic
986236438 5:5914772-5914794 TTTTCCCAAAAGACATTGGTTGG - Intergenic
986367104 5:7043300-7043322 TTTTTAAATAAGATCTCGGTGGG - Intergenic
987142956 5:14963813-14963835 TTTTTCAAAAAAAATTAGCTGGG - Intergenic
987664469 5:20919401-20919423 ATTTTTAAAAAGACATAGATTGG + Intergenic
987994407 5:25256603-25256625 TTTTTGGAAAAGACCTAAGGTGG + Intergenic
988467769 5:31507158-31507180 TTTTTTAAAACTACCTAGGCAGG + Intronic
988632964 5:32950994-32951016 TTTTTTAAAATGAGCTATGTAGG + Intergenic
988758212 5:34282791-34282813 ATTTTTAAAAAGACATAGATTGG - Intergenic
989671799 5:43925939-43925961 TTTTTGAAAAAGAACAAAGTTGG - Intergenic
990171250 5:53052537-53052559 TTTTTCAAAAAGAATTATGGTGG - Intronic
990411750 5:55548106-55548128 TTTATCAACAAGACCTTGTTTGG + Intergenic
990782443 5:59380812-59380834 TATTTCAAAGGGAGCTAGGTAGG + Intronic
992591156 5:78296885-78296907 TTTTTCATACAGACTCAGGTAGG + Intergenic
992995475 5:82328481-82328503 TCATTCAAGAAGACCTAGCTGGG - Intronic
993924542 5:93850388-93850410 TTATTGAGAAAGACGTAGGTAGG + Intronic
995100789 5:108302046-108302068 TTTTTCAGAAAGACATATGATGG - Intronic
997224465 5:132198574-132198596 GTTTTCACAAAGACCTAGTGAGG + Intronic
998288989 5:140894429-140894451 TTTTTAAAAAAGAGCTAGGTAGG - Intronic
998436419 5:142112893-142112915 TATTTTAGAAAGACCTAAGTAGG + Intronic
998698101 5:144664157-144664179 TTTTAGAAAAAGACCTATGGAGG - Intergenic
998812303 5:145978482-145978504 TTTTTCAAAAACACTTAGATGGG - Intronic
999935720 5:156483797-156483819 TTTTTAAAAAATACCTGGTTTGG + Intronic
1001411217 5:171513445-171513467 TTTTTAAAAAAGAAATAAGTTGG - Intergenic
1003124161 6:3342282-3342304 TTTTTCAAAAAGTCATTGGGTGG + Intronic
1003490709 6:6619175-6619197 TTTATCAAACAGATCTAGTTGGG - Intronic
1004291993 6:14375776-14375798 GTTTGCAAAAAGCCCTTGGTAGG - Intergenic
1005372284 6:25146603-25146625 TTCTTCAAGAAGAACAAGGTGGG + Intergenic
1005773964 6:29108646-29108668 TGTATCAAAAATACCTGGGTCGG - Intergenic
1006571853 6:35012182-35012204 TTTTTGAAAGAGACCTAGAGAGG + Intronic
1006994719 6:38248196-38248218 TTTTTAATAAACACCTAGATTGG + Intronic
1007147053 6:39646410-39646432 TTTTTCAGAAATACCTTGGAGGG - Intronic
1007435564 6:41808075-41808097 CTTTTCAAAAAGACGGATGTTGG - Intronic
1009551828 6:65106755-65106777 TCTTTCAAATAGACCTACATAGG + Intronic
1010431827 6:75786330-75786352 TTCTTCAAGAAGACCTAGACAGG - Intronic
1010451297 6:76006122-76006144 TTTTTCAAAAAGACCTAGGTGGG - Intronic
1010814867 6:80346038-80346060 CTTTTCAAAAAGAGGTAAGTCGG - Exonic
1011500155 6:87979374-87979396 TTTTATAAAAAGACATTGGTGGG - Intergenic
1011507096 6:88057524-88057546 TCTTAAGAAAAGACCTAGGTGGG + Intronic
1013487921 6:110616042-110616064 TTTTTCAAAGATACTTTGGTGGG - Intronic
1013557508 6:111271576-111271598 TTTTTTAAAAAAACCTAATTGGG + Intergenic
1015737542 6:136416914-136416936 TTTTTCAAATAGGCCTGGGCTGG - Intronic
1015785022 6:136914370-136914392 TTTTTCAAGAAAACTTAGGGAGG - Intergenic
1018990472 6:168669815-168669837 TTTGTCAAAAATATCTTGGTTGG + Intronic
1019054875 6:169215747-169215769 TTTTTTAAAAAGAACTAGCAGGG - Intergenic
1020152826 7:5696715-5696737 ATTTTCCAGAAGACCTAGGTGGG - Intronic
1020401337 7:7781322-7781344 TTTTTGAAAAAGAATAAGGTCGG - Intronic
1021442640 7:20695077-20695099 TTTTTTAAAAAGAGCAAAGTTGG + Intronic
1023215824 7:37861543-37861565 TTTTTAAAAAAAACCTAATTAGG + Intronic
1023411724 7:39894697-39894719 GCTTTCTAAAAGACCTATGTGGG - Intergenic
1023420442 7:39974025-39974047 ATCTTAAAAAAGACCTAAGTTGG - Intronic
1025839035 7:65126623-65126645 TTTCTGAAAAAGATCTGGGTAGG - Intergenic
1025884031 7:65569342-65569364 TTTCTGAAAAAGATCTGGGTAGG + Intergenic
1025889413 7:65633264-65633286 TTTCTGAAAAAGATCTGGGTAGG - Intergenic
1027241566 7:76333396-76333418 TTTTTCAAGAAGACTTTGCTGGG - Intronic
1027801598 7:82758666-82758688 TTTATGAAAAAGACCTTGATTGG - Exonic
1028015024 7:85698563-85698585 TTTTTCAAATTGGCCTAGCTAGG - Intergenic
1028031677 7:85922849-85922871 TTTTTAAAAAACACTTAGCTGGG - Intergenic
1028804063 7:95003924-95003946 TTATTCTAAAAGATCAAGGTAGG + Intronic
1030516258 7:110542242-110542264 TTTATCTAAAAGACCTAAGTAGG - Intergenic
1031858883 7:126955954-126955976 TTTTTAAAAAAGAACTTGGATGG + Intronic
1032654684 7:133915071-133915093 TTTTTCAAAAAGCAGTAGATGGG + Intronic
1032662160 7:133996571-133996593 TTTTCCAAAAAGACCTTCTTAGG + Intronic
1033447076 7:141432616-141432638 CTATTAAAAAAGAACTAGGTGGG - Intronic
1035891462 8:3348346-3348368 ATTTTCAAAATGAGCTAGGTGGG - Intronic
1037321944 8:17652176-17652198 TTTTTCAAAAAGACAAAGGTTGG + Intronic
1037663504 8:20946367-20946389 ATTTTGAAAAAGAACTGGGTTGG + Intergenic
1039842187 8:41302027-41302049 TTTTTAAAAAAGACAGAAGTTGG - Intronic
1040410587 8:47150465-47150487 TTTTTCAAAAAAAGCTAGAAGGG + Intergenic
1041174554 8:55180833-55180855 TTTTTAAAAAATACCTATTTTGG - Intronic
1041254070 8:55964125-55964147 CTTTTTAAAAGGACCTAGGATGG + Intronic
1042305142 8:67323322-67323344 TTTCTCCAAAAGACCTAACTGGG + Intronic
1043467169 8:80522113-80522135 TTTTTTTAAAAGATCTAGATGGG - Exonic
1043877871 8:85507080-85507102 TTTTTCAAAGATAGCTTGGTGGG + Intergenic
1044290040 8:90457529-90457551 TTTTACACAAAGACACAGGTAGG + Intergenic
1044981368 8:97719928-97719950 ATTTTACAAAAGGCCTAGGTTGG + Intronic
1045617421 8:103934193-103934215 TTTTTAAAAAAGGATTAGGTTGG + Intronic
1046253823 8:111669850-111669872 TTTTTCAAAAGGATTTAGGAAGG + Intergenic
1046332388 8:112736292-112736314 TTCTTCAAAAATACCTTTGTTGG + Intronic
1046834550 8:118785328-118785350 TTTTTCAAAAAAAAAAAGGTGGG - Intergenic
1046876928 8:119265349-119265371 TTTTTTAAAAAAACCTAATTCGG - Intergenic
1047006865 8:120629656-120629678 TTATTCAAAAAAATCTAGTTTGG + Intronic
1047269870 8:123346238-123346260 TTGGTCGAAAAGACATAGGTTGG + Exonic
1047539278 8:125748591-125748613 TTTCTCAAAGAGACCCAGGTTGG - Intergenic
1047891905 8:129321921-129321943 TTTTCCACAAAGCCCTTGGTTGG - Intergenic
1047998118 8:130356578-130356600 GTTTTCAAACAAACCTAGTTAGG + Intronic
1048179064 8:132178942-132178964 CTATTAAAAGAGACCTAGGTGGG + Intronic
1048191574 8:132294299-132294321 TCTTTCAAAAATACCTTAGTGGG - Intronic
1049909572 9:252500-252522 TTTTTAAAAAATTCCTATGTAGG + Intronic
1050114253 9:2246918-2246940 TTTTTAAAAAAGACTTATTTAGG - Intergenic
1052109987 9:24569965-24569987 TTCTAGAAAAAGACCTAGCTAGG - Intergenic
1052471522 9:28902053-28902075 TTTTATAAAAAGACATAGATTGG + Intergenic
1052962239 9:34308776-34308798 TTTTTTAAAAAGCTCTAGTTTGG + Intronic
1054729876 9:68690539-68690561 TTTTGCAAAAAGACTTACGTTGG - Intergenic
1055431450 9:76248078-76248100 TTTTTAAAAAAGATTAAGGTCGG - Intronic
1055535375 9:77237182-77237204 TTATTCAAAAAAATCTAGGCTGG - Intronic
1055737301 9:79344748-79344770 TATTTAAAAAATACCTAGGTTGG - Intergenic
1055743802 9:79420078-79420100 TTTAACAAAAAGAACTAAGTTGG - Intergenic
1055903163 9:81264188-81264210 TTTTTTAAAAATAACGAGGTGGG + Intergenic
1062241524 9:135542729-135542751 TTTTTAAAAAAGAATAAGGTGGG - Intergenic
1185711638 X:2308692-2308714 TTTTTCAAGAATTCCTAGGTAGG + Intronic
1185907589 X:3950362-3950384 TTTTTCAGAAAGGCCCAGGCGGG - Intergenic
1186466906 X:9790367-9790389 TATTTCACAAAGAGCTTGGTTGG - Intronic
1186569117 X:10695549-10695571 TTTTTCAAAAATACTTTGGTGGG - Intronic
1187627614 X:21133584-21133606 TTTTGCAAAAAGAACAAAGTTGG + Intergenic
1189395769 X:40621368-40621390 TTTTAAACAAAAACCTAGGTCGG - Intergenic
1189717392 X:43880914-43880936 ATTTTCTAAAACACCTAAGTAGG + Intronic
1189899775 X:45694206-45694228 TTTTTCAAAGTGACTTAGATCGG - Intergenic
1191664484 X:63685516-63685538 GTTTTGAAAAAGAACTAAGTTGG + Intronic
1195770900 X:108350086-108350108 TTTTTCAGAAAGACAAAGATGGG + Intronic
1198993626 X:142546714-142546736 TTAAGCAAAAAGACTTAGGTTGG - Intergenic
1199346078 X:146742167-146742189 TTTTTGAAAAAGACCAAAGTTGG - Intergenic
1199530903 X:148846653-148846675 TTGATTAAGAAGACCTAGGTGGG - Intronic
1199748316 X:150790491-150790513 TTTTTCAAAGTTACTTAGGTCGG - Intronic
1200407891 Y:2832326-2832348 CTTTTCAAAAAGAACAAAGTTGG + Intergenic
1202049975 Y:20770410-20770432 TATTTCAAATAGAGTTAGGTGGG - Intronic