ID: 1010454093

View in Genome Browser
Species Human (GRCh38)
Location 6:76035117-76035139
Sequence GCCCCTAGCACTCCACAAAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 111
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 102}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1010454093_1010454097 -5 Left 1010454093 6:76035117-76035139 CCAGTTTGTGGAGTGCTAGGGGC 0: 1
1: 0
2: 0
3: 8
4: 102
Right 1010454097 6:76035135-76035157 GGGGCACTGAAGGAGCAGGGAGG 0: 1
1: 0
2: 3
3: 68
4: 564
1010454093_1010454098 7 Left 1010454093 6:76035117-76035139 CCAGTTTGTGGAGTGCTAGGGGC 0: 1
1: 0
2: 0
3: 8
4: 102
Right 1010454098 6:76035147-76035169 GAGCAGGGAGGATGTCACTGTGG 0: 1
1: 1
2: 5
3: 47
4: 482
1010454093_1010454095 -9 Left 1010454093 6:76035117-76035139 CCAGTTTGTGGAGTGCTAGGGGC 0: 1
1: 0
2: 0
3: 8
4: 102
Right 1010454095 6:76035131-76035153 GCTAGGGGCACTGAAGGAGCAGG No data
1010454093_1010454099 18 Left 1010454093 6:76035117-76035139 CCAGTTTGTGGAGTGCTAGGGGC 0: 1
1: 0
2: 0
3: 8
4: 102
Right 1010454099 6:76035158-76035180 ATGTCACTGTGGCCAGAGCAAGG 0: 1
1: 1
2: 3
3: 37
4: 308
1010454093_1010454096 -8 Left 1010454093 6:76035117-76035139 CCAGTTTGTGGAGTGCTAGGGGC 0: 1
1: 0
2: 0
3: 8
4: 102
Right 1010454096 6:76035132-76035154 CTAGGGGCACTGAAGGAGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1010454093 Original CRISPR GCCCCTAGCACTCCACAAAC TGG (reversed) Intronic
903660909 1:24978020-24978042 TCCCCTATCTCTCCAGAAACTGG + Intergenic
904197132 1:28794322-28794344 GTCCCTAACACTTCGCAAACTGG - Intergenic
905222894 1:36461052-36461074 ACCCCTAGCACCTGACAAACAGG - Intronic
905362804 1:37431926-37431948 GCCCCTTACACACCACACACAGG + Intergenic
909529719 1:76668735-76668757 GCACCTAGCAGTTCCCAAACTGG - Intergenic
916180364 1:162078265-162078287 GTCCCTATCACTCAACAAGCTGG + Intronic
921932079 1:220762863-220762885 GGCCCCACCACTCCACAAAATGG - Intronic
922638595 1:227203109-227203131 TCCCCTAGCACCACACACACAGG + Intronic
922796168 1:228340885-228340907 GCCCCTGGCCCTCCCCAACCTGG - Exonic
1069720685 10:70547648-70547670 TCCCCTACCACTCCAGAATCTGG - Intronic
1069916767 10:71791350-71791372 GGCCCCAGCACCCCACAACCAGG + Intronic
1072518060 10:96205926-96205948 GTCACTATCACTCCACAACCTGG + Intronic
1072661049 10:97363737-97363759 GCACCGAGCATTCCAGAAACAGG + Intronic
1074972452 10:118550361-118550383 GTGACTATCACTCCACAAACTGG + Intergenic
1078875732 11:15394249-15394271 GCCCCCTGCATTCCACAAGCAGG - Intergenic
1080657156 11:34266997-34267019 TCCCCTACCACCCCACAAAAAGG - Intronic
1080873070 11:36253672-36253694 ACCCCTAGCTCTCCTCAAACTGG - Intergenic
1083808132 11:65087249-65087271 CCCCCTAGCCCTCCCCAAAGCGG + Intronic
1089731423 11:120521622-120521644 GCCTCTACCACCGCACAAACTGG - Intronic
1089818533 11:121199682-121199704 GCCCCTAGGAATCCACACACAGG - Intergenic
1089898008 11:121951347-121951369 GCCTCTAGAACTCCACAACGAGG + Intergenic
1090208755 11:124900455-124900477 GCACCTAGCTCTCCAAAACCTGG - Intergenic
1093061850 12:14615706-14615728 GACCATAGCAATCCATAAACTGG + Intronic
1098826624 12:75305660-75305682 GCCCCTAGCACTGCCCAGTCTGG + Intronic
1099218348 12:79881050-79881072 GCTCTGACCACTCCACAAACCGG + Intronic
1102623688 12:114217228-114217250 GCCCCTAGGACTGGAAAAACAGG - Intergenic
1103735555 12:123058653-123058675 GCCCCAAGCACTGCAGAAGCTGG + Intronic
1104246816 12:127050992-127051014 GCTCCTAACAGGCCACAAACTGG - Intergenic
1108525154 13:51280158-51280180 GCCCATTGCGCTCAACAAACTGG - Intronic
1108863646 13:54895086-54895108 GGCCCTAGCACCCAATAAACTGG + Intergenic
1114885286 14:26842396-26842418 ACCCCTACCACCCCACACACAGG + Intergenic
1115579842 14:34746898-34746920 GCACCTGCCACTCCACAACCAGG + Intergenic
1115955788 14:38777573-38777595 GCTCCTAACAGGCCACAAACTGG + Intergenic
1115993289 14:39171094-39171116 GTCCCTTGCACCCCACTAACAGG - Intergenic
1121242364 14:92440002-92440024 GCCCTGGGCACTCCACACACAGG - Intronic
1121514297 14:94539148-94539170 GCACCTCTCACTCCACAAAACGG - Intergenic
1122775621 14:104115864-104115886 GCCCCTCGGACTCCACACCCAGG + Intergenic
1127268010 15:57376613-57376635 GCCCCTAGCACCCCGAAACCCGG - Intronic
1132324849 15:100960178-100960200 GACCCTGGAACTACACAAACAGG - Intronic
1135055908 16:19231956-19231978 GCTCCTCTCACTCCACAGACTGG - Intronic
1137251850 16:46747046-46747068 ACCCCTAGCTGTCCCCAAACAGG + Intronic
1137379205 16:47981921-47981943 GCCCCCAGGAGTCCACATACAGG + Intergenic
1138022497 16:53497281-53497303 GCTTCTTGCACTCCACAACCAGG + Intronic
1141169327 16:81681143-81681165 TCCCCAAGCCCTCCACAAAATGG + Intronic
1144862674 17:18315330-18315352 GCTCCTAGGACGCCACAACCCGG - Exonic
1148035312 17:44655882-44655904 GCTCCTCGCCCTCCCCAAACCGG + Intergenic
1148111498 17:45147128-45147150 GCCCCCAGCCCTCCATAAACAGG - Intergenic
1148547418 17:48528795-48528817 GCCCCCAGCAAGCCACAACCAGG - Exonic
1152244108 17:79176375-79176397 GCCCCCAGCACCCCCCAAGCAGG + Intronic
1152660454 17:81539661-81539683 GCCCCTCCCACTCCACAGAGAGG + Intergenic
1159570684 18:70109057-70109079 GCATCTAGAACTGCACAAACTGG + Intronic
1161739388 19:6011320-6011342 GCCCCCACCACACCACACACCGG - Intronic
1163616625 19:18332960-18332982 GCCCCCTGCAGTCCTCAAACTGG + Intergenic
1163801499 19:19368437-19368459 GCCCCTAATACTTCACACACCGG + Intergenic
1165008941 19:32829130-32829152 GCCCCCAGAGCTCCACCAACAGG - Intronic
1166907562 19:46123788-46123810 GCCGTTAGAACTCCACAAACAGG + Intronic
1167358359 19:49017318-49017340 GTCCCTAGCACTCGACAACTGGG - Intergenic
1168464240 19:56589300-56589322 GCCCCTCACACTCCACAGAGAGG + Intergenic
927452806 2:23223509-23223531 ACCCCTGGCACTCAACAAATGGG + Intergenic
927878271 2:26673344-26673366 GCCCCTAGCAATGCACAAGGGGG + Intergenic
928020830 2:27703522-27703544 GCACCTAGCAGTTCACAAATTGG + Intergenic
929561750 2:42960601-42960623 GGCCCTACCACAGCACAAACTGG - Intergenic
941776174 2:169395996-169396018 TCCCCCAGCACTCCACACCCAGG + Intergenic
942453845 2:176124550-176124572 ACCCCCAGCACTGCCCAAACAGG + Exonic
948947632 2:241229132-241229154 GCTGATTGCACTCCACAAACAGG + Exonic
1172038305 20:32025954-32025976 TCCCCTACCCCTGCACAAACAGG + Intronic
1174064292 20:47853499-47853521 GCTCCTAACAGTCCACAAATTGG + Intergenic
1175415073 20:58795716-58795738 GCCCAGAACACTCCACACACTGG - Intergenic
1175704135 20:61163210-61163232 TCCCCAAGCCCTCCACAAGCAGG + Intergenic
1175744860 20:61449099-61449121 GCCCCTGGCACTGCACACAGTGG - Intronic
1175945879 20:62558524-62558546 GCACCCAGCACTCCTGAAACAGG - Intronic
1177832215 21:26151810-26151832 GCTCCTAACACGCCACAGACCGG + Intronic
1178325298 21:31640946-31640968 GTTCCTAGCAGTCCACAGACTGG + Intergenic
1182320861 22:29478039-29478061 GCCCCTTGCCCTCTGCAAACTGG + Intergenic
950572686 3:13811773-13811795 GCCCCCAGCAATGCACACACTGG + Intergenic
952998205 3:38905731-38905753 GCAGCTAGCACTTCACAATCTGG - Intronic
954262934 3:49452935-49452957 GCCTCCAGGAGTCCACAAACTGG + Intergenic
958532420 3:95350356-95350378 TCCCCAAGCACTGCACAATCAGG + Intergenic
961126567 3:124423985-124424007 GCCCATAGCACTCAACAAAATGG - Intronic
968832070 4:2937578-2937600 GCCCCTTGAACTTCACAAGCTGG - Intergenic
975791510 4:77957817-77957839 GCCCATAGCACTAAACAAACTGG + Intergenic
982545275 4:156725123-156725145 GCCCCTTGCTCTCCACATAGGGG + Intergenic
983733089 4:171022423-171022445 CCCCCCAGCACCCCACAAACAGG - Intergenic
991114033 5:62933161-62933183 GCCCCTAGCACTCAGCTGACAGG - Intergenic
995897306 5:117029874-117029896 GAACCCAGGACTCCACAAACTGG + Intergenic
999147731 5:149407001-149407023 CCCCCAACCACTCCCCAAACAGG + Intergenic
1001484351 5:172109171-172109193 GCCCCTCTCACTCCAAAAAGGGG + Intronic
1002823176 6:747803-747825 GCCTCTAAGACACCACAAACGGG - Intergenic
1006878861 6:37321740-37321762 GGCTCTAGGACTCCACAGACAGG - Intronic
1010454093 6:76035117-76035139 GCCCCTAGCACTCCACAAACTGG - Intronic
1017450903 6:154553573-154553595 GCCCATAACACTTCACAAATAGG - Intergenic
1017825069 6:158075740-158075762 CCCTTTAGCACTCCACACACTGG - Intronic
1024393318 7:48839406-48839428 GCCCCTCCCACTACACAACCAGG - Intergenic
1024623221 7:51181709-51181731 GCCCCTTGCAATCCACAGAGAGG + Intronic
1024623229 7:51181787-51181809 GTCCCTTGCAATCCACGAACGGG + Intronic
1028518886 7:91707348-91707370 GCCCCTATCTCTCCACATCCTGG + Intronic
1031237666 7:119197301-119197323 GCCCTTTTCACTCCACACACAGG + Intergenic
1035865467 8:3077008-3077030 GCACTTAGGACTCCAAAAACAGG - Intronic
1035962404 8:4151976-4151998 CCCCCTAGCAAACCACAAGCAGG - Intronic
1036463269 8:8973201-8973223 GCCCCAAGCGCTCCACAAAATGG + Intergenic
1037743079 8:21622692-21622714 GCCCCTAGCCCCAGACAAACTGG + Intergenic
1038418964 8:27419942-27419964 GCCCATAGCACTCAGCCAACCGG - Exonic
1038541806 8:28396046-28396068 ACCCCTAGCCCTCCACAGAAGGG + Intronic
1041970388 8:63734395-63734417 GCCCCTAAAAGTCCACAAAATGG - Intergenic
1043078305 8:75730792-75730814 TCACCCAGCACTCAACAAACAGG - Intergenic
1048167502 8:132076474-132076496 GCCCCCAGATATCCACAAACAGG - Exonic
1051677251 9:19570959-19570981 GGCCCTAGGTCTCCACAAAGGGG - Intronic
1052652924 9:31326228-31326250 GCCCCTTGCTCACCACAAAGTGG - Intergenic
1061759812 9:132842841-132842863 GCCCCTAGCAAGCGAGAAACCGG - Intronic
1189593936 X:42544094-42544116 GACCCTAGGGCTCCACAATCAGG - Intergenic
1198968234 X:142250426-142250448 GCCCTCTGCACTCCACACACAGG - Intergenic