ID: 1010455022

View in Genome Browser
Species Human (GRCh38)
Location 6:76044631-76044653
Sequence TCCACCTGGAAAAAAATTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 306
Summary {0: 1, 1: 0, 2: 2, 3: 28, 4: 275}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1010455022_1010455027 12 Left 1010455022 6:76044631-76044653 CCTGGAATTTTTTTCCAGGTGGA 0: 1
1: 0
2: 2
3: 28
4: 275
Right 1010455027 6:76044666-76044688 CTAACACTTTGCGCATATCCAGG 0: 1
1: 0
2: 0
3: 1
4: 33

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1010455022 Original CRISPR TCCACCTGGAAAAAAATTCC AGG (reversed) Intronic
902853233 1:19178445-19178467 TCCACCAGGAAAAATATAGCGGG + Intronic
903302167 1:22386790-22386812 TCCACCTCCAAGAAAAGTCCAGG - Intergenic
904244285 1:29175393-29175415 TCCATCTCAAAAAAAATTTCCGG + Intronic
904937498 1:34141892-34141914 TCCACCTTCAAAATAAATCCAGG - Intronic
906862229 1:49373783-49373805 TCCTCCTCTAAAAAGATTCCTGG - Intronic
907349107 1:53811399-53811421 TCCACCTGGAAACAGACTCAGGG + Intronic
910858195 1:91717427-91717449 TCCACCTGCAGATATATTCCCGG + Intronic
911663822 1:100532493-100532515 GCTATCTGGAAAAAAATTACTGG - Intergenic
913501603 1:119477146-119477168 TGCACCTGGAAAAAAATGATGGG + Intergenic
914410053 1:147418718-147418740 TACATCTGAAAAAAAATTTCTGG + Intergenic
915838671 1:159198352-159198374 TCCACATGGAAAATCAATCCTGG - Intronic
916300073 1:163263893-163263915 TACACCTGGACAAAAATGTCAGG - Intronic
916548613 1:165828772-165828794 TCCACCTGCAGAAAAAACCCCGG - Intronic
916869065 1:168892668-168892690 TCTTCCTGGAAAAAAATTAACGG - Intergenic
917406820 1:174715875-174715897 TGCAGCTGGAAAAGAATACCAGG - Intronic
917469798 1:175316622-175316644 TCCAGCTTGAAAAAAATGACTGG + Exonic
917783939 1:178432078-178432100 TACTCTTGGTAAAAAATTCCAGG - Intronic
918588551 1:186215774-186215796 TCCACATTGAAAACAATTACTGG + Intergenic
918842683 1:189563591-189563613 TCCACATCCTAAAAAATTCCAGG - Intergenic
919649991 1:200138516-200138538 TACACTTGGAAAAAAATTAAAGG - Intronic
921076354 1:211703005-211703027 TGCAGCTGCATAAAAATTCCTGG + Intergenic
922203894 1:223430138-223430160 TTAACCTGCAAAAATATTCCAGG - Intergenic
922255230 1:223887826-223887848 TCAACTTGGAAAAAAATTCAGGG + Intergenic
922673438 1:227532574-227532596 TCCACCTGGAAACAGACTCAGGG - Intergenic
924246126 1:242086953-242086975 CCCTCCTGGAAAGTAATTCCTGG + Exonic
924657947 1:245990466-245990488 TCGACCTTGAATAAAATTTCTGG + Intronic
924686606 1:246298587-246298609 TCCACCAGGTAAAAACTTTCTGG + Intronic
1064479188 10:15722151-15722173 TCCATCTCAAAAAAAATTCAAGG + Intergenic
1064887578 10:20128017-20128039 TCAACCTAGACAGAAATTCCAGG + Intronic
1066121214 10:32289417-32289439 TCCCCCTGCAAAAAAAGTCCAGG + Intronic
1072175255 10:92914287-92914309 TCCACCTGCAAAAAAAGCCTGGG + Intronic
1075271649 10:121057185-121057207 TCCAGCAGGAAAAAAATTCCTGG - Intergenic
1076146754 10:128128018-128128040 TCCACATTAACAAAAATTCCTGG + Intergenic
1076784021 10:132740147-132740169 TCCACCTGGAGAAGCATTACTGG - Intronic
1077072172 11:680230-680252 TCCAGCTCAAAAAAAAATCCTGG + Intronic
1077851840 11:6080443-6080465 TTCACCCAGAAAAAAATTCAAGG - Intergenic
1079175517 11:18136853-18136875 TCCACCTGAGAGAAAATTTCAGG + Intronic
1079268338 11:18957341-18957363 TCCACCTGAGAGAAAATTTCAGG - Intergenic
1081213110 11:40360199-40360221 ACCATTTGGAGAAAAATTCCAGG + Intronic
1081346320 11:41991483-41991505 TCCAAATTGAAAAAAATTACTGG - Intergenic
1081938376 11:46919946-46919968 TGCATCTGGATAAAAATTTCAGG - Intergenic
1082665800 11:55973920-55973942 TCGATCTGTAAATAAATTCCAGG - Intergenic
1082854206 11:57791791-57791813 CACCCCTGGAAAAAAATCCCTGG - Intronic
1084186090 11:67472446-67472468 TTCACCTGGGAAAGAATTCAAGG + Intergenic
1086929523 11:92677493-92677515 TCCTGCTGGCAGAAAATTCCAGG - Intronic
1087619444 11:100525450-100525472 ACCACCTGGAAAAAGACTCGAGG + Intergenic
1088137754 11:106578166-106578188 TCCACCTGGAAACAGACTCGGGG - Intergenic
1092083256 12:5735504-5735526 TCTACTTGGAGAAAAGTTCCAGG - Intronic
1092868570 12:12785750-12785772 TTCACCTGGAAAATTATCCCTGG + Intronic
1093172527 12:15875824-15875846 TCCACCTGGAAACAAACTCAGGG + Intronic
1093844726 12:23955850-23955872 TCAACCTGGAAAGTAATTCAGGG + Intergenic
1094300394 12:28958170-28958192 TCCTGCTGGACAAAGATTCCAGG - Intergenic
1094381580 12:29848942-29848964 TCCACCTGGTTCAAACTTCCCGG - Intergenic
1095549217 12:43413387-43413409 TACACCTTGAAAAAAGTTACAGG + Intronic
1097404340 12:59171592-59171614 TCCATTTGGAAAAAAATACTTGG + Intergenic
1097954604 12:65470598-65470620 TACATCTGGAAAAAATCTCCAGG + Intronic
1099908010 12:88794814-88794836 CTCCCCTGGAAAAATATTCCTGG - Intergenic
1101635310 12:106535632-106535654 ACCACCTGGAAACAGATTCAGGG - Intronic
1102713632 12:114951141-114951163 TCCAGGTGTAAAAATATTCCAGG + Intergenic
1104297725 12:127532687-127532709 TAAAGCTGGAAAAAAATTCATGG - Intergenic
1106866552 13:33970598-33970620 TTCACTTGGAAAATAATTCCAGG + Intergenic
1107675403 13:42791282-42791304 TCCACATGGAAACTAATTCAGGG + Exonic
1107702858 13:43065979-43066001 TCAAACTGAAAAAAAATGCCAGG - Intronic
1108306823 13:49145104-49145126 TTACCCTGAAAAAAAATTCCTGG + Intronic
1108497454 13:51039708-51039730 TCCTCCTGGAAAAAAAGTCTTGG - Intergenic
1109238936 13:59859556-59859578 TTCCCCAGGAAAAAAACTCCCGG + Intronic
1109304655 13:60625304-60625326 TCCACCTGTAAAACAAATCAAGG - Intergenic
1110042169 13:70776206-70776228 GCCACCTGAAAAAAGAATCCAGG + Intergenic
1111165798 13:84455716-84455738 TCCACCTGGAAACAGACTCAGGG - Intergenic
1112322923 13:98423353-98423375 TCAAAGTGGAAAAAAATACCCGG - Intronic
1112629833 13:101148513-101148535 TCCAGCTGGACAAAAATTTTGGG + Intronic
1112729150 13:102340181-102340203 TGCAACTGGAAAGAAATTCAGGG - Intronic
1112945277 13:104920120-104920142 TCCACCTGGAAACAGACTCGGGG + Intergenic
1112966069 13:105195870-105195892 TTCACCTGGGAAAGAATTCAAGG + Intergenic
1114897220 14:27006312-27006334 TCCACCAGGAACAAAATATCAGG + Intergenic
1115483475 14:33885877-33885899 ACCACCTGAAAAATAACTCCTGG + Intergenic
1116411240 14:44626202-44626224 TACACCTGGCATAAAATTTCAGG + Intergenic
1119593295 14:75910278-75910300 ACCTCTTGGAAAAAAATGCCTGG + Intronic
1120622289 14:86778797-86778819 TCAACCTGGAAAACTAGTCCAGG - Intergenic
1121371728 14:93364783-93364805 ACTACCTGGAAAAAAATCCCAGG - Intronic
1121885927 14:97542629-97542651 GCCACCTGGGATAAAACTCCAGG - Intergenic
1126191702 15:45885445-45885467 TCCAGATGGAAGAAGATTCCAGG + Intergenic
1126577459 15:50210763-50210785 TCCACCTGGAAACAGACTCGGGG + Intronic
1126878216 15:53066876-53066898 TCAACATGGAAAAATACTCCAGG + Intergenic
1128238678 15:66084924-66084946 TACACCTGGAAACAGACTCCGGG + Intronic
1131641613 15:94299304-94299326 TACACTTAAAAAAAAATTCCAGG - Intronic
1134590895 16:15452424-15452446 TCCAGATGGCAGAAAATTCCGGG + Intronic
1135190618 16:20351401-20351423 TCCAATTGGAAAAATAGTCCAGG + Intronic
1135658115 16:24269263-24269285 TTCTTCTGGAAAAAAATTCAAGG - Intronic
1135684551 16:24487954-24487976 TCCACCTTAGAAAAAAGTCCAGG - Intergenic
1137683449 16:50370100-50370122 TTCACCTGGAAAACAGTCCCAGG + Intergenic
1138139157 16:54552216-54552238 GCAACGTGCAAAAAAATTCCTGG - Intergenic
1138198217 16:55069942-55069964 CTCACCTGGAAAACATTTCCTGG - Intergenic
1138868745 16:60854096-60854118 TCTATCTGAAAAAAAATTCAAGG + Intergenic
1140153198 16:72393613-72393635 TCCTCCTAGAACAAAATTCCTGG - Intergenic
1140770862 16:78202840-78202862 TCCATGTAGAAAAGAATTCCTGG + Intronic
1141252660 16:82372425-82372447 TCCAACTGGCAAAATATTCCTGG - Intergenic
1141330851 16:83109237-83109259 TCCACCTGGGAAAATTTCCCAGG - Intronic
1142358338 16:89614460-89614482 TCCACCTGGAAGGAAATTGTGGG - Intronic
1142536856 17:623872-623894 TCCACCAGGCAAAAAAATCAGGG + Intronic
1142903726 17:3028804-3028826 TCCATCTCGAAAAAAAATCAGGG - Intronic
1149009435 17:51839811-51839833 TCCACATGAAAATCAATTCCAGG + Intronic
1149642999 17:58216988-58217010 CCCCCCCAGAAAAAAATTCCTGG - Intronic
1150061492 17:62072633-62072655 TCCTCCTGCTAAAAAGTTCCAGG + Intergenic
1151934537 17:77253993-77254015 TTCACCGGGAAAAATCTTCCTGG - Intergenic
1153459246 18:5315640-5315662 TACATTTGGAAAAAACTTCCAGG - Intergenic
1153965974 18:10182308-10182330 TCCACCTGGAAACAGACTCAGGG - Intergenic
1155199795 18:23506780-23506802 TCCAACTGGAAAGAACTTGCTGG - Intronic
1156141533 18:34117606-34117628 TCCGCCTGGAAAAAATTAACAGG + Intronic
1156380611 18:36556931-36556953 TTCACCTGGTATAAAATTCTAGG + Intronic
1156531998 18:37826375-37826397 TCCACATGGAAAATCATTCCTGG - Intergenic
1158331555 18:56368230-56368252 TCCACCTGGAAACAGACTCTGGG - Intergenic
1160140326 18:76315830-76315852 TCCACATGCAAAAAAATGACAGG + Intergenic
1160301297 18:77681990-77682012 TACACCTGGGAAATAATTCCAGG - Intergenic
1160512416 18:79460017-79460039 TCCTCTAGGAAAAAAATTACAGG - Intronic
1160610174 18:80078346-80078368 TCCACCGGGAAAAAGATGACTGG - Intronic
1161248016 19:3265332-3265354 TTCACCTGGGAAAGAATTCAAGG + Intronic
1161893944 19:7065978-7066000 TCTACCTGGAAAAAAGTCCATGG + Intergenic
1164237806 19:23352167-23352189 TCCACCTGGAAACAGACTCGGGG + Intronic
1164735241 19:30536295-30536317 ACCACCTGGAGGAAGATTCCAGG - Intronic
1164779859 19:30883622-30883644 TTCACCTAGAAAAGAATTCAAGG - Intergenic
1164790779 19:30978635-30978657 TTCACCAGGAAAAAAATTCCAGG + Intergenic
1165703179 19:37954152-37954174 TCCACCAAGAAAAAATTCCCAGG - Intronic
1165819335 19:38664730-38664752 TCCACCTGGTTAAGACTTCCGGG + Intronic
1166350928 19:42197764-42197786 GCCACGTGGAGACAAATTCCAGG + Intergenic
925944453 2:8847811-8847833 TCCCCCTGGAAAAAATTTTTCGG + Intergenic
926493320 2:13553163-13553185 TCCACCAGCAAAAAGATTACAGG - Intergenic
926837713 2:17042708-17042730 TTCTCCTTGAGAAAAATTCCTGG + Intergenic
926916047 2:17893282-17893304 TCCACCTGGAAACAGACTCCAGG - Intronic
927323294 2:21773298-21773320 TCAGCCTGGACAAAACTTCCAGG - Intergenic
927327671 2:21824560-21824582 TCCACTTGGAAAAATACTCTAGG - Intergenic
930188773 2:48436642-48436664 TCCAGTTTGAAAAAAATTCAGGG - Intergenic
932874635 2:75437591-75437613 TGCACCTAGAAATATATTCCAGG - Intergenic
934866689 2:97820556-97820578 CCCACCTGTAAAAAAAATCCTGG + Intronic
937428291 2:121817726-121817748 TCCCCCTGGAGAAGAGTTCCAGG + Intergenic
938626380 2:133113647-133113669 CCCATTTGGAAACAAATTCCTGG - Intronic
943018017 2:182537874-182537896 TACACCTAGAACAAAATTCCAGG - Intergenic
944111233 2:196132810-196132832 TGCAGCTGGAAAAAAATGTCTGG - Intergenic
944213409 2:197230159-197230181 TCAACCTTTAAAAAAATTCTTGG - Intronic
944398137 2:199293117-199293139 TTCACCTGCATCAAAATTCCAGG - Intronic
945825605 2:214716964-214716986 TCCACCTGGAAACAGACTCAGGG + Intergenic
945864498 2:215161513-215161535 TCCACCTGGAAACAGACTCTGGG + Intergenic
1170077325 20:12433879-12433901 ACCACCTGGAAGGAAATTCCAGG - Intergenic
1170375857 20:15699614-15699636 TCCGCCTGGAAACAAACTCGGGG - Intronic
1170979840 20:21201385-21201407 TGCACCTGGAAAAAAATAAATGG - Intronic
1170982033 20:21223304-21223326 TAAACCTGAAAACAAATTCCAGG - Intronic
1172164682 20:32891992-32892014 TGCAGCTGGAATAAAATCCCAGG - Intronic
1172525344 20:35597610-35597632 TCCACCTGGAACACCATTACAGG + Intergenic
1173185690 20:40838342-40838364 TTGAACAGGAAAAAAATTCCAGG + Intergenic
1173885205 20:46451457-46451479 TCCATCTCAAAAAAAATTACTGG - Intergenic
1174279238 20:49426828-49426850 TTCACCGGGAAACAAATACCTGG - Intronic
1175123887 20:56737404-56737426 TCCATCTGGAATGAAATGCCAGG - Intergenic
1175242857 20:57562617-57562639 TCTACCTGGGAAAAAAATGCTGG + Intronic
1177115913 21:17087015-17087037 TTCAACTTGAAAAAAATTGCAGG - Intergenic
1177174478 21:17689396-17689418 TCCTCCTGGAAACAGATTCTGGG - Intergenic
1177340849 21:19797804-19797826 TCCACCTAGAAAAAAATTAAGGG + Intergenic
1178918689 21:36724009-36724031 TCCTCCTGGAAGAAAGTTTCTGG - Intronic
1178939660 21:36894491-36894513 TGAACCTGGGAAGAAATTCCTGG - Intronic
1179210850 21:39323131-39323153 TCCACCTGGAGAAAGCTTCCTGG + Intergenic
1179524676 21:41967926-41967948 TCAGCCTGGAAAACAATGCCAGG + Intergenic
1181370074 22:22408924-22408946 TCCACCAGGAAGAGCATTCCTGG + Intergenic
1182081897 22:27535288-27535310 TCCACCAGGAAAAGATTCCCTGG - Intergenic
1182505244 22:30777587-30777609 TCCATCTGTAAAGAAATGCCTGG + Intronic
1183048485 22:35241288-35241310 TCCACCTGGAAACATATTTGGGG - Intergenic
1184975501 22:48058709-48058731 CCCACCTGGAGAGAAACTCCAGG + Intergenic
1185298836 22:50068551-50068573 TCCACCTGGAAAAAAAGCGCGGG + Exonic
1185358142 22:50387441-50387463 TCCACCGGGGAAAAAAGACCAGG - Intronic
951216161 3:20027252-20027274 TCCAGCTGTTAAAACATTCCAGG + Intergenic
955149010 3:56348284-56348306 TCCACCAGGAAAAAAACTCTGGG + Intronic
955871200 3:63440583-63440605 TCTATCTGGAAAAAAATACGAGG + Intronic
956009083 3:64811319-64811341 TGCAACTGGAAACAAATGCCTGG + Intergenic
956239723 3:67116305-67116327 TCCACCTGGGAAATAAAACCAGG + Intergenic
956973874 3:74557861-74557883 TCTACCTGGAAAAATTTACCAGG - Intergenic
957892401 3:86377246-86377268 CCCATCTGGAAAAAATCTCCTGG - Intergenic
958830675 3:99084980-99085002 TGCACCTATAAAAAATTTCCTGG - Intergenic
959404525 3:105943922-105943944 TCAACCTGCAAAGTAATTCCAGG - Intergenic
960512884 3:118571834-118571856 TCCACCTGGAAACAGACTCAGGG - Intergenic
961056001 3:123789402-123789424 GCCATTTGGTAAAAAATTCCTGG + Intronic
961864820 3:129945900-129945922 TCCATCTGCAAAAACACTCCTGG + Intergenic
964449917 3:156802136-156802158 TGCAGCTGGAACAAATTTCCAGG + Intergenic
965539804 3:169860661-169860683 TCCACCTACAAAACCATTCCAGG + Exonic
966189902 3:177262626-177262648 TACACCTGGAAAAACAACCCTGG - Intergenic
966543340 3:181116544-181116566 TCCCTCTGGAAAAAAATACATGG - Intergenic
972043204 4:34630186-34630208 TACATATGGAAAAAAATTACAGG + Intergenic
972343599 4:38174388-38174410 TCCAAATGGAAAAAAATACTAGG - Intergenic
975033776 4:69657003-69657025 TCCACCTGGAAACAGACTCCAGG + Intergenic
976703889 4:88001925-88001947 AACAACTGGAAAAAAATTTCTGG + Intergenic
978201368 4:106027284-106027306 GCCAACAGGAAAAAAATGCCAGG - Intergenic
978715420 4:111836952-111836974 TCCACCTCCAAAAACACTCCAGG + Intergenic
979094051 4:116521191-116521213 ACAAACTGGAAAGAAATTCCGGG + Intergenic
979995434 4:127425995-127426017 TCCACCTGGAAACAGACTCAGGG + Intergenic
981758485 4:148167837-148167859 TCTACCTAGAAAACAATTCCAGG + Intronic
981761738 4:148202267-148202289 TCCCCCTGGAAAAAAGATCAAGG - Intronic
983274345 4:165599437-165599459 TTCACTTAAAAAAAAATTCCAGG - Intergenic
983410613 4:167392796-167392818 TACACCTGAAATATAATTCCTGG - Intergenic
983449749 4:167895256-167895278 TCCACCTGGAAACAGACTCGGGG + Intergenic
983818375 4:172161313-172161335 TCCACTTGGAAATAAGTTACAGG + Intronic
984444312 4:179815308-179815330 TCCACATGGAAAGAAATAGCAGG + Intergenic
986228714 5:5841973-5841995 TCCACATCGAGAACAATTCCTGG - Intergenic
986838819 5:11672532-11672554 TCCACCTGGTTCAAACTTCCTGG + Intronic
987197175 5:15538097-15538119 TGCTCCTGGATAAAAATTCAAGG - Intronic
987660954 5:20875289-20875311 ACCAACCTGAAAAAAATTCCTGG + Intergenic
987674420 5:21056185-21056207 TACACCTGAAAAAAAATCACGGG + Intergenic
988442906 5:31252006-31252028 TCCATCAAGAAAAAAATTCTGGG + Intronic
988762684 5:34330400-34330422 ACCAACCTGAAAAAAATTCCTGG - Intergenic
989492798 5:42077210-42077232 TCCCCCTGGGAAAAAGTGCCTGG + Intergenic
990028931 5:51231808-51231830 TCCACCTTGAGAAAGTTTCCAGG - Intergenic
990754114 5:59049133-59049155 TCCACCTGGAAATAATTTGCTGG + Intronic
991511077 5:67376744-67376766 TCCATCAGGAAAAAAACTCTGGG - Intergenic
991776801 5:70093197-70093219 TAAAACTGGAAAAAAATTTCTGG - Intergenic
991856088 5:70968642-70968664 TAAAACTGGAAAAAAATTTCTGG - Exonic
991870102 5:71101415-71101437 TAAAACTGGAAAAAAATTTCTGG - Intergenic
992080178 5:73229344-73229366 ACAACCTGGAAAAACATTCAGGG + Intergenic
994761591 5:103861286-103861308 ACCCCCTGGAAAAAAATCACTGG - Intergenic
999414013 5:151379040-151379062 CCCACCTGGGAGAAATTTCCAGG - Intergenic
1001197563 5:169687075-169687097 TTCTCCTGGAAGAAAATTGCTGG + Intronic
1001215821 5:169854810-169854832 TCCACCAGAAAGAAAATTCTGGG - Intronic
1001905007 5:175464724-175464746 TGCACCTGGAAACAAAAACCTGG + Intergenic
1003152174 6:3562170-3562192 TCTGTCTGGAAAAAAATTTCTGG + Intergenic
1003718400 6:8673228-8673250 TACCCCTGGAAAAAAAATGCTGG + Intergenic
1003743520 6:8971086-8971108 CCTACCTGAAAAAAAATTGCTGG - Intergenic
1003993689 6:11515599-11515621 ACCATCTGGAAAAAATCTCCAGG + Intergenic
1006242212 6:32693058-32693080 TCTACCAGTAAATAAATTCCAGG + Intergenic
1006587852 6:35129739-35129761 TTCACCTTGAAAAAAATACAAGG + Intronic
1007469923 6:42082896-42082918 CGCTCCTGGAAAAAAATTCAAGG + Exonic
1007875434 6:45095032-45095054 ACCATCTGGGAAAAAATTCTCGG - Intronic
1009780882 6:68267903-68267925 TACACCTGGAAAAAGATTGCTGG - Intergenic
1010455022 6:76044631-76044653 TCCACCTGGAAAAAAATTCCAGG - Intronic
1010759076 6:79701248-79701270 TCCAGTTAAAAAAAAATTCCTGG - Exonic
1011228033 6:85129202-85129224 TCCACCTGGACACAAAAGCCAGG + Intergenic
1013721080 6:113028565-113028587 TCCACCTGGAAACAGACTCTGGG - Intergenic
1014539183 6:122653309-122653331 GTCACCTGGAAAAACAATCCAGG - Intronic
1014595791 6:123336496-123336518 TTCTCCAGGAAAAAACTTCCTGG + Intronic
1015368950 6:132428825-132428847 TCTACATGGAAAAAAAATCAGGG + Intergenic
1015846794 6:137528738-137528760 TCATACTTGAAAAAAATTCCAGG - Intergenic
1017371795 6:153719179-153719201 TCTACCTGAAAAAAAACTCTAGG + Intergenic
1017510424 6:155109785-155109807 CCCAGCTGGAAGGAAATTCCAGG + Intronic
1018168383 6:161122864-161122886 AACAACTGGAAACAAATTCCCGG - Intergenic
1018262245 6:161982105-161982127 TACACCTGGAATAAACTTCAAGG - Intronic
1019318440 7:402480-402502 TCCACCTAGGAAAGAATTCAAGG - Intergenic
1020167102 7:5816179-5816201 TCCACTGGGAAAAAAATAACAGG - Intergenic
1020446324 7:8272404-8272426 AGCACCTGGAAAAAGTTTCCGGG - Intergenic
1020585774 7:10064728-10064750 TCTACCTTGAAAAAGTTTCCAGG + Intergenic
1020614304 7:10439447-10439469 TTCTCCTGGAAAAAAATACAGGG + Intergenic
1021151296 7:17153644-17153666 TCCACATGGCAAAAAATGGCGGG - Intergenic
1022195904 7:28067089-28067111 ACCACCTGGACAAAAACTCTAGG + Intronic
1022590382 7:31655581-31655603 TCCACCAGAAATAAAAGTCCAGG + Intronic
1022786636 7:33644543-33644565 TCCACTTGGAAAAAGATTATGGG - Intergenic
1026825080 7:73576676-73576698 TCCAACAGGAAAAAAGCTCCTGG + Intronic
1029153974 7:98501942-98501964 TCAACCTTAAAAAAACTTCCTGG - Intergenic
1030317602 7:108132521-108132543 TCAGCCTGGGAAGAAATTCCTGG + Intergenic
1030333640 7:108299443-108299465 TCTATCTGAAAAAAAATTCTTGG - Intronic
1031861403 7:126983811-126983833 TCCACCAGGAAAAAAACCCACGG + Intronic
1035027102 7:155833268-155833290 ATCACCTGGAAGATAATTCCTGG - Intergenic
1036249198 8:7147259-7147281 GCCATCTGAAAAAAAATTGCAGG + Intergenic
1037431827 8:18821444-18821466 TCCTCATGAAAAAAAATTACAGG + Intronic
1038719408 8:30020330-30020352 GGCATCTGGACAAAAATTCCTGG - Intergenic
1039703178 8:39981703-39981725 TCCACCCGAGAAAAAATTCAAGG + Intronic
1042159848 8:65881656-65881678 TCCACATGGAAAGAAATCACAGG - Intergenic
1042316306 8:67429977-67429999 GCCCCCTGGAAAATAATTCTTGG - Intronic
1043085014 8:75819171-75819193 ACCACCTGGCAAAAAATTGTGGG - Intergenic
1043103386 8:76076498-76076520 TCCATCCTGAAAAAAATTTCTGG - Intergenic
1044428452 8:92081668-92081690 TCCACCTGGAAAAAAAAAAATGG + Intronic
1047032324 8:120896202-120896224 TCCACCTGGAAGCAGACTCCGGG + Intergenic
1047065099 8:121273099-121273121 TACACCTGGAAACAAATTCTGGG - Intergenic
1047154350 8:122300175-122300197 TCCACCAGGAAGAAAATTTTAGG + Intergenic
1048664242 8:136643189-136643211 TTCAGCAGGAAAAAAAATCCAGG - Intergenic
1049320352 8:141992877-141992899 TCCACCTGGAACAGAAGGCCAGG - Intergenic
1049332584 8:142063142-142063164 GCCACCTGGACAAAAACCCCTGG - Intergenic
1049933669 9:480089-480111 TCCATCTGGTAAATAATTGCCGG + Intronic
1050192825 9:3046310-3046332 TCCACATGGAACAAAAATGCTGG + Intergenic
1051951974 9:22646973-22646995 TTCACCTGGAAAGAAATATCAGG - Intergenic
1053416807 9:37951943-37951965 TTCACCTGGAAAGAGAATCCAGG + Intronic
1054693028 9:68333356-68333378 TTCACCTGGAAACTAATTCAAGG - Intronic
1056429114 9:86509320-86509342 TCCACCAGGAGACTAATTCCAGG + Intergenic
1058085078 9:100739937-100739959 TCCACCTGGAAACAGACTCCGGG - Intergenic
1058177094 9:101748556-101748578 TCCACATGGAAAGGAACTCCAGG - Intergenic
1058594279 9:106598777-106598799 TGCATCTGGAAAAAAATTTGGGG - Intergenic
1058623239 9:106905758-106905780 TCCACCTGGAAACAGACTCGGGG - Intronic
1060359927 9:122945063-122945085 TCCCACTGAAAAAAAATTCAAGG + Intronic
1185513213 X:678303-678325 TCCACCTGGGAACAAAATGCTGG - Intergenic
1185513254 X:678500-678522 TCCACCTGGGAACAAAATGCTGG - Intergenic
1185513294 X:678697-678719 TCCACCTGGGAACAAAATGCTGG - Intergenic
1185513335 X:678894-678916 TCCACCTGGGAACAAAATGCTGG - Intergenic
1186260386 X:7772242-7772264 TGCACCTGGACAAACATTCGAGG - Intergenic
1186491246 X:9974751-9974773 TTCACCTGACAATAAATTCCTGG + Intergenic
1187748347 X:22433469-22433491 TCCACCTGGAAAAAGACTTGGGG + Intergenic
1189218126 X:39344832-39344854 TCCACCTGGAAACAGACTCAGGG + Intergenic
1190763578 X:53457063-53457085 TGAACCTGGAAAGAAAATCCAGG - Intergenic
1192075327 X:67989642-67989664 TGCAGCTGGAAAAAAATAACTGG + Intergenic
1192682813 X:73269020-73269042 TCAACCTGGAAACAAAATACCGG + Intergenic
1192979083 X:76319314-76319336 TCCACCTAGAAAAAGACTCAGGG - Intergenic
1193079016 X:77386922-77386944 TCTCCCAGTAAAAAAATTCCAGG + Intergenic
1193420771 X:81279959-81279981 TCCACCTGGAAACAGACTCAGGG + Intronic
1193643920 X:84044212-84044234 TCCACCTGGAAACAGACTCAGGG - Intergenic
1193779679 X:85686424-85686446 TCCACCTGGAAACAGACTCAGGG - Intergenic
1194081791 X:89476407-89476429 TGCCCCTGGAAAAAAATGCCTGG + Intergenic
1194466750 X:94242913-94242935 TCCACATGGGGAAATATTCCAGG + Intergenic
1195223379 X:102767971-102767993 TCCACATGGAAAAACATACCAGG + Intergenic
1196948163 X:120849570-120849592 TTCACCTGAAAAAGAATTCAGGG - Intergenic
1197588876 X:128384032-128384054 TCCACCTGGAAACAGACTCAGGG + Intergenic
1198595266 X:138229227-138229249 TCCACTTAGAAAAAAATACAGGG + Intergenic
1199203474 X:145120741-145120763 TCCAGCTGGAAAACAGTTCTGGG - Intergenic
1200434460 Y:3132597-3132619 TGCCCCTGGAAAAAAATGCCTGG + Intergenic
1201143981 Y:11052425-11052447 TCCACCAGGAAAAAGATTACAGG + Intergenic
1202043689 Y:20714447-20714469 TCTACCTGGAAACAAACTCAGGG + Intergenic