ID: 1010455940

View in Genome Browser
Species Human (GRCh38)
Location 6:76054789-76054811
Sequence GTCCACTGGTTTGCTGGAAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 114
Summary {0: 1, 1: 0, 2: 0, 3: 22, 4: 91}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1010455940_1010455945 25 Left 1010455940 6:76054789-76054811 CCAGTTCCAGCAAACCAGTGGAC 0: 1
1: 0
2: 0
3: 22
4: 91
Right 1010455945 6:76054837-76054859 TTACAAAGGCAAAGACAGACAGG No data
1010455940_1010455943 -7 Left 1010455940 6:76054789-76054811 CCAGTTCCAGCAAACCAGTGGAC 0: 1
1: 0
2: 0
3: 22
4: 91
Right 1010455943 6:76054805-76054827 AGTGGACAAAGTTCATTATTAGG 0: 1
1: 0
2: 0
3: 19
4: 207
1010455940_1010455944 11 Left 1010455940 6:76054789-76054811 CCAGTTCCAGCAAACCAGTGGAC 0: 1
1: 0
2: 0
3: 22
4: 91
Right 1010455944 6:76054823-76054845 TTAGGCAGAAGACATTACAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1010455940 Original CRISPR GTCCACTGGTTTGCTGGAAC TGG (reversed) Intronic
902098984 1:13969461-13969483 TTCCAGTGGTTTGCTGGTAATGG - Intergenic
903552082 1:24164604-24164626 GTCCCCTGGTTTGATTGAAGGGG + Intronic
905687606 1:39919827-39919849 GTTCAGTGCTGTGCTGGAACTGG + Intergenic
906186064 1:43862908-43862930 GTCCACTGTTTTTTTGAAACTGG - Intronic
911969921 1:104419585-104419607 GCCAACTGGCTTGCTGGATCAGG + Intergenic
915717463 1:157957847-157957869 GTCTACTGGTTTACTGGATGGGG - Intergenic
918041774 1:180918025-180918047 GTCCACTGGTCTGCTGGTGCAGG - Intronic
919758500 1:201081397-201081419 GTCCACCGTGTTGTTGGAACTGG + Intronic
922720282 1:227896776-227896798 GGCCACTGCTTTGCAGGAAGAGG - Intergenic
1064585718 10:16837629-16837651 GTTCAGTGGTTAGCTGGCACTGG - Intronic
1066370859 10:34816721-34816743 CTGCACTGATTTGCTGGGACAGG - Intergenic
1075020208 10:118946564-118946586 GACCACTGGTGTGCTGGAGCGGG + Intergenic
1075242968 10:120794549-120794571 GCCCAGTGGTGTCCTGGAACTGG - Intergenic
1079960053 11:26912949-26912971 GTACACTGGTGTGCTGTAACTGG - Intergenic
1085565334 11:77508520-77508542 ACTCAGTGGTTTGCTGGAACTGG - Intergenic
1086306118 11:85482807-85482829 GACCATGGGTCTGCTGGAACAGG - Intronic
1087059566 11:93964296-93964318 GTCCACTTGGTTGCTGCCACTGG - Intergenic
1087811649 11:102614758-102614780 ACTCACTGGTGTGCTGGAACAGG + Intronic
1090640849 11:128727786-128727808 ATGCAGTGGTGTGCTGGAACTGG - Intronic
1094371970 12:29748737-29748759 TCTCACTGGTGTGCTGGAACTGG + Intronic
1095254939 12:40023436-40023458 GTACACTTGTTCGCTGGTACAGG + Intronic
1095568452 12:43654128-43654150 ATCCACTGGTGTGCTGGACCTGG + Intergenic
1097936294 12:65255808-65255830 GACCAGTGGTTTGCTAGATCTGG + Intergenic
1103536808 12:121638968-121638990 GTCCACAGGTCTCCAGGAACTGG + Intronic
1105755242 13:23457736-23457758 GCCCAGTGGTATGCTGGAACTGG + Intergenic
1113012859 13:105790581-105790603 GACCATTGGTTTGCTTGAACAGG + Intergenic
1113302370 13:109036127-109036149 GTCCAGGGGTTGGCTGGAGCTGG - Intronic
1113878205 13:113607770-113607792 GGCCAGTGGTTTCCTGGACCTGG + Intronic
1122214594 14:100194446-100194468 CTCTACTGATTTGCTGGCACTGG + Intergenic
1132411503 15:101581630-101581652 CTCCTCTGGTTGGATGGAACAGG + Intergenic
1133639357 16:7701916-7701938 GCACCCTGGTTTGCTGCAACAGG - Intronic
1134456657 16:14400178-14400200 TTCCACTTGTTTTCTGTAACTGG - Intergenic
1135636540 16:24080579-24080601 GTCCACTGGTTATCTTGTACTGG - Intronic
1135675386 16:24411004-24411026 GTCCAGTGGTGTGCTGGGGCTGG - Intergenic
1137389081 16:48066616-48066638 GTCCACTGGCTTCCAGGAAGAGG + Intergenic
1141691413 16:85598845-85598867 GGCCCCTTGTTTGCTGGAGCAGG + Intergenic
1145022859 17:19445713-19445735 GTCCACTGTTTTGTTTGATCAGG + Intergenic
1146083535 17:29805494-29805516 GTCCGCTGGTGTGCTGGAGCTGG + Intronic
1147322797 17:39656369-39656391 GTCCAGAGGTTTGAGGGAACTGG - Intronic
1148702090 17:49594271-49594293 GTCCAGTGGTGTGCTGGAGCTGG + Intergenic
1149284782 17:55150396-55150418 GGACACTGGTCTGATGGAACTGG - Intronic
1150450281 17:65260906-65260928 CTCCACTGGCTTGCTGGAAGAGG + Intergenic
1152646404 17:81470709-81470731 GTCCCCTGCTTTGATGGGACAGG - Intergenic
1155855108 18:30824245-30824267 ATCTACTGGTTAGCTGGAACTGG - Intergenic
1160154351 18:76422224-76422246 GTCTCCTGGTTTGCTGGGTCAGG - Intronic
1160741024 19:685887-685909 GGCCCCTGGTGTGCAGGAACCGG - Exonic
1168105727 19:54164751-54164773 GGCCGCTGGTTTCCTGGAGCAGG - Intronic
925475175 2:4205522-4205544 GGGCACTGGTTAGCTGGTACTGG + Intergenic
927105996 2:19826262-19826284 TTCAACTCGTATGCTGGAACTGG - Intergenic
927146497 2:20169619-20169641 GTCCACAGGTTTCCTGGAGAGGG - Intergenic
928398076 2:30958301-30958323 GTCCACTGGTTTTCTGGGAATGG - Intronic
930185289 2:48407194-48407216 GTCCACTGGTTTGCTAGACTTGG - Intergenic
932009602 2:67961818-67961840 GTCCACTGTTTCACTGGAAAAGG + Intergenic
935112879 2:100108101-100108123 GTCTGCAGCTTTGCTGGAACAGG - Intronic
940620028 2:156100573-156100595 GTCCATTGGATTGCAGAAACAGG - Intergenic
942946779 2:181681606-181681628 GGCCACTGGGTTGCTGGAAAGGG + Intergenic
943396660 2:187345854-187345876 ATGCAATGGTGTGCTGGAACTGG + Exonic
946699626 2:222398775-222398797 ATCCAGTGTTTTGGTGGAACTGG - Intergenic
948997134 2:241587275-241587297 GTCCATCTGTTTGCTGGAGCTGG + Intronic
1172110044 20:32539165-32539187 GCCCAGTGCTTTGCTGGAGCAGG - Intronic
1180669548 22:17542592-17542614 GTCCACTGGTTGGGGGGGACAGG - Exonic
1184740813 22:46428143-46428165 GTCCTCCGGTTTGTTGCAACCGG + Intronic
953256717 3:41297584-41297606 GGACACTGATTTGCTGGATCTGG - Intronic
954092268 3:48294656-48294678 GTCCACTATGTAGCTGGAACAGG - Exonic
959451960 3:106516260-106516282 GTTCACTGTTTTCCTGGACCAGG - Intergenic
959645372 3:108693581-108693603 GTCCAGTGGTATGCTGGTAAAGG - Exonic
964192711 3:154023508-154023530 CCCCACTGGTGTGCTGAAACTGG - Intergenic
965726773 3:171725366-171725388 CTCAACTAGTTTGCTAGAACTGG - Intronic
966650457 3:182294968-182294990 GGCCATTGGTGTGCTGGAATGGG - Intergenic
968523402 4:1044642-1044664 GTCCTCTGCTCTGCTGGAGCTGG + Intergenic
970749278 4:19337731-19337753 GTGCACTGGTTTGAAGAAACAGG - Intergenic
974089339 4:57295098-57295120 GGCCCCTGGGTTTCTGGAACAGG - Intergenic
974784826 4:66606429-66606451 AACCACTGGTTTGCTGGAGCTGG - Intergenic
975243887 4:72095235-72095257 GTCTGCTGGTGTGCTGGAACTGG + Intronic
977284162 4:95081426-95081448 GTCAACTGTTTTCCTTGAACTGG - Intronic
984958044 4:185065524-185065546 GTCCACTTTCTTTCTGGAACAGG - Intergenic
986628084 5:9741666-9741688 CTCCACTGGGATGCTTGAACAGG - Intergenic
991388724 5:66118983-66119005 TTCCACTGGTTTGCTATAATAGG + Intergenic
992888927 5:81185942-81185964 ATCAACTGGTTTACTGGGACTGG + Intronic
997116612 5:131132137-131132159 ATCCACTGGTGTGCTGGAGCTGG + Intergenic
1001987569 5:176088117-176088139 GTCCATTGGTTTCATCGAACAGG + Intronic
1002229301 5:177750024-177750046 GTCCATTGGTTTCATCGAACAGG - Intronic
1002266044 5:178033748-178033770 GTCCATTGGTTTCATCGAACAGG + Intronic
1004670995 6:17796726-17796748 GGCCACCGGTGTGCTGGAAATGG - Exonic
1007171371 6:39865651-39865673 GCCCCGTGGTGTGCTGGAACTGG + Intronic
1008893683 6:56526489-56526511 GAGCAGTGCTTTGCTGGAACTGG - Exonic
1009523445 6:64713830-64713852 TTCCACTGGATTCCTGGAAGGGG + Intronic
1010455940 6:76054789-76054811 GTCCACTGGTTTGCTGGAACTGG - Intronic
1011905548 6:92362625-92362647 GGCCAGTGGTGTGCTGGAGCTGG + Intergenic
1012575282 6:100788831-100788853 GACCAGTGGTCTGCAGGAACTGG + Intronic
1015670579 6:135685408-135685430 GATCAGTGGTGTGCTGGAACTGG - Intergenic
1015863609 6:137705811-137705833 GTCCACTGCAGTGCTGGAATTGG - Intergenic
1028021177 7:85775628-85775650 GCCCACTGGCTTGCTGGAAAGGG - Intergenic
1028470073 7:91196351-91196373 TTCCAGTGGTGTTCTGGAACTGG - Intronic
1033204287 7:139404180-139404202 GTAAACTGGTTTGTTGGGACTGG + Intronic
1035592233 8:824816-824838 GCCCACTGGTTTGGTGGCACAGG + Intergenic
1037414818 8:18638913-18638935 GTCAACTGGATTTCTGGAAAAGG + Intronic
1038020115 8:23545552-23545574 GTCCACTGATTCCCTGGCACAGG + Intronic
1039033718 8:33336546-33336568 ACCCAGTGGTTTCCTGGAACTGG - Intergenic
1039433039 8:37540524-37540546 CTCCTCTGGTTTTCTGGAAATGG + Intergenic
1047012044 8:120683318-120683340 GATCATTGTTTTGCTGGAACTGG - Intronic
1048361782 8:133703649-133703671 GGCCACTGGTTTCCTGCAGCAGG + Intergenic
1050406559 9:5314620-5314642 GTACCCTGCTTTCCTGGAACTGG + Intergenic
1053423565 9:37996610-37996632 GTCCACTGATGTGCTGGCTCTGG + Intronic
1057750771 9:97791011-97791033 GTCCACTCCCTTGCTGGAGCAGG - Intergenic
1058285694 9:103175509-103175531 GTACATTTGTTTGCTGGTACAGG + Intergenic
1060373595 9:123098437-123098459 GTCCACAGGTTGGCTTGTACTGG + Intronic
1062388410 9:136324377-136324399 CTCCACTGGTTTGCTAGGGCTGG - Intergenic
1062393637 9:136343822-136343844 GGCCACTGGGCTGCTGGAACAGG - Intronic
1062541574 9:137043967-137043989 CTCCACTGGCTTGCTGTGACTGG - Intronic
1188771864 X:34162959-34162981 GACCTCGGGTTTGCTGGAACAGG + Intergenic
1190470142 X:50770466-50770488 GACAACTGGTTTGCTGGGACAGG + Intronic
1195561126 X:106285097-106285119 GTCCAGTGGTGTTCTGGAGCTGG - Intergenic
1195765278 X:108289838-108289860 TTCCAGTGGTGTGCTGGAACTGG + Intronic