ID: 1010456885

View in Genome Browser
Species Human (GRCh38)
Location 6:76066338-76066360
Sequence ACTCATAGACTGAAGCTAAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1532
Summary {0: 1, 1: 0, 2: 14, 3: 261, 4: 1256}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1010456882_1010456885 13 Left 1010456882 6:76066302-76066324 CCAATGATGTGCTGCTTATAAAA 0: 1
1: 1
2: 5
3: 33
4: 336
Right 1010456885 6:76066338-76066360 ACTCATAGACTGAAGCTAAAGGG 0: 1
1: 0
2: 14
3: 261
4: 1256

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1010456885 Original CRISPR ACTCATAGACTGAAGCTAAA GGG Intronic
900010857 1:106645-106667 ACACAGAGACTGAAGCTTGAAGG - Intergenic
900026959 1:283209-283231 ACACAGAGACTGAAGCTTGAAGG - Intergenic
900904315 1:5541248-5541270 ACACATAGACTGAAAGTGAAGGG - Intergenic
901189410 1:7398469-7398491 ACTAATAAACTGAAAGTAAAGGG - Intronic
904275101 1:29377583-29377605 ACACATAGACTGAAAATGAAAGG - Intergenic
904422143 1:30400991-30401013 GCTCATGGACTGAGGCTTAAAGG + Intergenic
905964310 1:42078592-42078614 ACATATAGGCTGAAGGTAAAGGG - Intergenic
906594262 1:47060334-47060356 ACTCATAGGTTCAAGATAAAGGG + Intergenic
906904863 1:49879029-49879051 ACACATAGGCTGAAAATAAAAGG - Intronic
907003369 1:50885548-50885570 ACATATAGACTGAAAATAAAGGG - Intronic
907624304 1:56013095-56013117 ACCCATAGACTCAAAATAAAGGG + Intergenic
907986378 1:59535104-59535126 ACACATAGACTCAAAATAAAAGG + Intronic
908362956 1:63387949-63387971 ACACATAGACTGAAAATAAAAGG - Intronic
908712819 1:67036640-67036662 TCACATAGACTGAAAATAAAGGG - Intronic
908968985 1:69802580-69802602 ACTTACAAACTGAAGGTAAAGGG - Intronic
909420968 1:75464657-75464679 ACACATAAACTGAAAATAAAGGG + Intronic
909720646 1:78765602-78765624 ACACACAGACTGAAAATAAAGGG - Intergenic
909874575 1:80785776-80785798 ACACATAGACTCAAAATAAAGGG + Intergenic
910230166 1:84977514-84977536 ACACATAGACTGAAAATAAAGGG + Intronic
910330888 1:86071522-86071544 ACACATAGACTGAAAATAAAGGG + Intronic
910379024 1:86606197-86606219 ACACATAGACTAAAAATAAAGGG - Intergenic
910384629 1:86667217-86667239 ACACATAGACTAAAAGTAAAGGG + Intergenic
910384691 1:86668362-86668384 ACACATAGACTGAAAATAAAGGG + Intergenic
910612176 1:89156476-89156498 ACACATAGTCTCAAGATAAAGGG + Intronic
910635476 1:89403338-89403360 ACACATAGGCTCAAGATAAAGGG - Intergenic
910733409 1:90423762-90423784 ACACATAGACTAAAAATAAAAGG + Intergenic
910801076 1:91146933-91146955 ACACACAGACTGAAAATAAAGGG - Intergenic
911106505 1:94136370-94136392 ACACATAGACTCAAAATAAAGGG + Intergenic
911548676 1:99253262-99253284 ACTCATATACTGAACCTCAAAGG + Intergenic
911824088 1:102459119-102459141 ACACATAGGCTGAAACTGAAGGG - Intergenic
911975715 1:104491935-104491957 ACACATAGACTGTAAATAAAGGG + Intergenic
912110634 1:106337550-106337572 ACTCATATGTGGAAGCTAAAAGG - Intergenic
912266765 1:108165662-108165684 ACACATAGACTCAAAATAAAAGG - Intronic
912280333 1:108305949-108305971 ACACATAGACTGAAAATAAAGGG - Intergenic
912287893 1:108388408-108388430 ACACATAGACTGAAAATAAAGGG + Intronic
912606817 1:110999683-110999705 ACACATAGACTGAAAATAAAGGG - Intergenic
912616659 1:111108178-111108200 ACACATAGACTGAAAGTGAATGG - Intergenic
912639191 1:111328716-111328738 ACTCATAGGCTGAAAATAGAGGG - Intergenic
912899914 1:113637098-113637120 ACACATAGACTCAAAATAAAAGG - Intronic
913036059 1:114967550-114967572 ACACATAGACTCAAAATAAAGGG - Intronic
913146814 1:115999969-115999991 ACACATAGACTGAAAATAAAGGG - Intronic
913410856 1:118549838-118549860 ACTCATAGGCTCAAAATAAAGGG + Intergenic
913493305 1:119403198-119403220 ACACATAGGCTCAAGATAAAGGG - Intergenic
913504109 1:119499925-119499947 ACACATAGACTCAAAATAAAGGG + Intergenic
913506572 1:119521922-119521944 ACACATAGACTCAAAATAAAGGG + Intergenic
913942961 1:125125194-125125216 ACACATAGACTCAAAATAAAGGG + Intergenic
913985488 1:143561968-143561990 ACACATAGGCTGAAAATAAAAGG - Intergenic
913990144 1:143603940-143603962 ACACATAGGCTGAAAATAAAAGG + Intergenic
914142891 1:144966763-144966785 ACACATAGGCTGAAAATAAAAGG + Intronic
914189637 1:145397857-145397879 ACACATAGGCTCAAACTAAAGGG + Intronic
914208505 1:145557186-145557208 ACACATAGACTCAAAATAAAGGG - Intergenic
914458938 1:147863892-147863914 ACACATAGACTCAAAATAAAGGG + Intergenic
915071220 1:153270003-153270025 ACACATAGACTGAAAGTGAAGGG - Intergenic
915750791 1:158208239-158208261 ACTTATAGACTGAAAGTAAAGGG - Intergenic
915844116 1:159245449-159245471 ACACACAGACTGAAAGTAAAGGG - Intergenic
915857118 1:159400349-159400371 ACACATAGAATGAAAATAAAGGG + Intergenic
915865850 1:159498107-159498129 ACACATACACTGAAAGTAAAGGG - Intergenic
915907963 1:159893053-159893075 ACTCTCAGACTGAAGACAAAGGG - Intronic
916224802 1:162479040-162479062 ATTCATAGACTGAAAATGAAGGG + Intergenic
916322091 1:163515867-163515889 AGACATAGACTGAAAATAAAGGG + Intergenic
916593988 1:166224909-166224931 ACACATAGACTGAAATTAAAGGG - Intergenic
916617940 1:166462955-166462977 ACACATACACTGAAAGTAAAGGG - Intergenic
917003099 1:170382941-170382963 ACACATAGACTGAAAATAAAGGG - Intergenic
917010571 1:170466134-170466156 ACACATAGACTCAAAATAAAGGG + Intergenic
917058263 1:171007565-171007587 GCTCCCAAACTGAAGCTAAAAGG + Intronic
917158268 1:172027695-172027717 ACACATAGACTCAAAATAAAGGG + Intronic
917226149 1:172785690-172785712 ACACATAGACTAAAAATAAAAGG - Intergenic
917246048 1:173002249-173002271 ACAAATAGACTGAAAGTAAAGGG - Intergenic
917294606 1:173505625-173505647 ACTCCTACACTGATGCTCAAGGG + Intronic
917364255 1:174211755-174211777 ACACATAGACTGAAAATAAAAGG + Intronic
917981293 1:180271383-180271405 ACTCAGAGGCTGGAGCTAAGCGG + Exonic
918415847 1:184307598-184307620 ACACATAGACTGAAAATAAAAGG - Intergenic
918475945 1:184925274-184925296 ACACATAGGCTGAAAATAAAGGG - Intronic
918619966 1:186591881-186591903 ACTCATAGGCTCAAAGTAAAGGG + Intergenic
918620887 1:186604144-186604166 ACACATAGACTGGAAGTAAAGGG - Intergenic
918789694 1:188810963-188810985 ACACATAGACTCAAAATAAAGGG - Intergenic
918824078 1:189299491-189299513 ACACATAGACTCAAAATAAAGGG - Intergenic
918867293 1:189919151-189919173 ACCCACAGGCTGAAGGTAAATGG - Intergenic
918959416 1:191253681-191253703 ACACATAGACTGAAAATGAAAGG - Intergenic
919147120 1:193650360-193650382 ACTAACAGACTGAAAATAAAAGG - Intergenic
919374254 1:196772874-196772896 ACTCATAGTCTGAAAGTAAAAGG - Intergenic
920596441 1:207276575-207276597 ACACATAGACTGAAAATAAAAGG - Intergenic
921002574 1:211058864-211058886 ACACACAGACTGAAAATAAAGGG + Intronic
921241164 1:213185249-213185271 ACACATAGACTGAAAGTGAAGGG - Intronic
921295859 1:213702777-213702799 ACACATATACTGAAAATAAAGGG - Intergenic
921471389 1:215554781-215554803 ACACATAGACTGAAAGAAAAGGG - Intergenic
921746522 1:218746411-218746433 ACGCATAGACTGAAAATAAAGGG + Intergenic
921823433 1:219643455-219643477 ACACATAGACTGAAAATAAAGGG + Intergenic
922045726 1:221944504-221944526 ACACATAGACTGAAAATAAAGGG + Intergenic
922259303 1:223922652-223922674 ACACAGAGACTGAAGCTTGAAGG - Intergenic
922380524 1:225019193-225019215 ACCCATAGACTCAAAGTAAAGGG + Intronic
922388312 1:225111496-225111518 ACACATAGACTGAAACTAAAAGG - Intronic
922399404 1:225237062-225237084 ACACATAGGCTGAAAATAAAGGG - Intronic
923122452 1:231004760-231004782 ACTCATAAACTTAAGGCAAAGGG + Intergenic
924193596 1:241581191-241581213 ACACATCGACTGAAAATAAAAGG - Intronic
924340483 1:243025398-243025420 ACACAGAGACTGAAGCTTGAAGG - Intergenic
924492046 1:244547917-244547939 ACACATAAACTGAAAGTAAAGGG + Intronic
924868303 1:248010820-248010842 ACACATAGACTCAAAATAAAGGG - Intronic
924949477 1:248868894-248868916 ACACATATACTGAAAGTAAAGGG + Intergenic
1062762666 10:37596-37618 ACACATAGACTCAAAATAAAAGG + Intergenic
1063550009 10:7022941-7022963 ACACACAGACTGAAGGTAAAGGG + Intergenic
1063736585 10:8762377-8762399 AATGATAGACTAAAGGTAAAAGG + Intergenic
1063736593 10:8762487-8762509 AATGATAGACTAAAGGTAAAAGG + Intergenic
1063736600 10:8762596-8762618 AATGATAGACTAAAGGTAAAAGG + Intergenic
1064170781 10:13030614-13030636 ACACATAGGCTCAAGATAAAGGG + Intronic
1064446807 10:15401663-15401685 ACACATAGACTGAAAATAAAGGG + Intergenic
1064641464 10:17419648-17419670 AGTCATAGACAGAAGAAAAAAGG + Intronic
1064696560 10:17972700-17972722 ACACATAGACTAAAAATAAAGGG - Intronic
1064700978 10:18021487-18021509 ACCCATAGACTCAAAGTAAAGGG - Intronic
1065080323 10:22123128-22123150 ACACATAGACTCAAAATAAAGGG - Intergenic
1065119149 10:22512098-22512120 ACACATAGGCTGAAAATAAAGGG - Intergenic
1066097986 10:32091636-32091658 ATTCATAGACTCAAGATAAAGGG - Intergenic
1066257421 10:33694180-33694202 ACTCATAGGCTCAAAATAAAGGG - Intergenic
1066639412 10:37540209-37540231 ACACATAGACTCAAAATAAAGGG + Intergenic
1067132991 10:43582881-43582903 ACGCATAGACTGAAAGTGAAGGG - Intergenic
1067212399 10:44270576-44270598 ACACATAGACTCAAAATAAAAGG + Intergenic
1067673611 10:48348896-48348918 ACTCATAGGCTCAAAATAAAGGG + Intronic
1068314681 10:55324364-55324386 ACGCATAGACTCAAAGTAAAGGG + Intronic
1068368176 10:56078794-56078816 AATTATAGACTCAAGGTAAAGGG + Intergenic
1068383468 10:56291647-56291669 ACACATAGACTGAAAGTAAAGGG - Intergenic
1068436538 10:56999433-56999455 TCTTATAGACTCAAGGTAAAGGG + Intergenic
1068451305 10:57192672-57192694 ACACATAGCCTGAAAATAAAGGG - Intergenic
1068477755 10:57550148-57550170 ACACATAGACTCAAAATAAAGGG - Intergenic
1069218283 10:65850586-65850608 ACTAATAGACAGAATCTACAAGG + Intergenic
1069397459 10:68005401-68005423 ACACATACACTGAAAATAAAGGG - Intronic
1070059078 10:72964913-72964935 ACACATAGACTAAAAATAAAGGG - Intergenic
1070317728 10:75332028-75332050 AAACATAGACTGAAGGTGAAGGG - Intergenic
1070631806 10:78090586-78090608 ACACATAGGCTGAAAATAAAAGG + Intergenic
1070632723 10:78098641-78098663 ACTCATAGCCTCAAAATAAAGGG + Intergenic
1071004780 10:80870439-80870461 ACACATAGACTGAAAGTGAAGGG + Intergenic
1071999725 10:91183434-91183456 ACACATAGACTCAAAATAAAAGG - Intronic
1072401659 10:95109144-95109166 ACACATAGACTCAAAATAAAGGG - Intergenic
1072843302 10:98799063-98799085 ACACATAGACTGAAAATAAAGGG + Intronic
1073161807 10:101404540-101404562 ACTTGTAGACTGAAGCCAACTGG - Intronic
1073872646 10:107882920-107882942 ACACATAGACTAAACATAAAGGG + Intergenic
1074226671 10:111491222-111491244 ACACATAGACTGAAGATAAAGGG - Intergenic
1074635534 10:115311971-115311993 TCTTATAGACTCAAGGTAAAGGG - Intronic
1074804272 10:117032028-117032050 ACACATAGACTGAAAATAAAGGG + Intronic
1076580703 10:131508432-131508454 ACACATAGGCTCAAACTAAAGGG - Intergenic
1077428446 11:2499590-2499612 ACACATAGACTGAAAATTAAGGG + Intronic
1077584339 11:3439336-3439358 AGGCATGGACTGAAGCTCAAGGG - Intergenic
1077741979 11:4856344-4856366 ACACATAGGCTGAAAATAAAGGG + Intronic
1078037029 11:7816982-7817004 ACACATAGACTGAAAACAAAGGG + Intergenic
1078244322 11:9559938-9559960 ACACATAAACTGAAAATAAAGGG - Intergenic
1078615297 11:12859720-12859742 AATGATAGACTGAATCTAAGGGG + Intronic
1078807250 11:14718043-14718065 ACACATAGGCTGAAAATAAAAGG + Intronic
1078834735 11:15016471-15016493 ACACATAGACTGAAAATAAAGGG + Intronic
1078876220 11:15401040-15401062 ACACACAGACTGGAGGTAAAGGG - Intergenic
1079267284 11:18945438-18945460 ACACATAGGCTCAAGATAAAGGG + Intergenic
1079272037 11:18997302-18997324 AAACATAGACTGAAAATAAAAGG - Intergenic
1080033359 11:27686265-27686287 ACACATAGGCTGAAAATAAAGGG - Intronic
1080128820 11:28769212-28769234 ACTCATAGATTGAAAATAAAGGG + Intergenic
1080203153 11:29697639-29697661 TCACATAGACTTAAGGTAAAGGG - Intergenic
1080482402 11:32665527-32665549 ACACATAGGCTCAAGATAAAGGG - Intronic
1080488904 11:32741545-32741567 ACACATAGACTAAAAATAAAGGG - Intronic
1080906074 11:36546446-36546468 ACACATAGACTCAAAATAAAGGG - Intronic
1080917602 11:36675665-36675687 ACACATAGGCTTAAACTAAAGGG + Intergenic
1081094728 11:38919199-38919221 ACACATAGACTCAAAATAAAGGG - Intergenic
1081099469 11:38984332-38984354 ACACATAGGCTGAATGTAAATGG + Intergenic
1081212305 11:40351885-40351907 ACACATAGGCTGAAAATAAAGGG - Intronic
1081310582 11:41566577-41566599 ACACATAGACTGAATGTGAAGGG - Intergenic
1081539561 11:44021497-44021519 ACTAATATACAGAAGCTACAAGG - Intergenic
1081958667 11:47117003-47117025 ACACATAGGCTGAAAATAAAGGG - Intronic
1082211855 11:49513716-49513738 ACTCATAGGCTCAAAATAAAGGG + Intergenic
1082606162 11:55236695-55236717 ACACATAGACTCAAAATAAAAGG - Intergenic
1082738392 11:56883041-56883063 TTTCATAGACTGAACCTACATGG + Intergenic
1082970439 11:59015134-59015156 CCACATAGACTGAAAATAAAGGG + Intronic
1083008807 11:59374314-59374336 ACACATAGGCTGAAAATAAAGGG + Intergenic
1083385286 11:62304508-62304530 ACACATAGACTTAAAATAAAGGG - Intergenic
1083512483 11:63224300-63224322 ACACATAGACTGAAAATAAAGGG - Intronic
1083910648 11:65707257-65707279 ACTCCTAGACTCAAGCTGTAGGG - Intergenic
1084831200 11:71770646-71770668 AGGCATGGACTGAAGCTCAAGGG + Intergenic
1085223692 11:74898533-74898555 ACACATAGACTAAAAATAAAGGG + Intronic
1085248202 11:75121582-75121604 ACACACAGACTGAAAATAAAGGG + Intronic
1086033377 11:82386840-82386862 ACACATAGACTGAAAATAAAGGG + Intergenic
1086085806 11:82954231-82954253 ACACATAGACTCAAAATAAAGGG - Intronic
1086312060 11:85546873-85546895 ACACATAGGCTGAAAATAAAGGG - Intronic
1086569864 11:88269506-88269528 ACATATAGACTGAAACTAAAGGG + Intergenic
1086637783 11:89111114-89111136 ACTCATAGGCTCAAAATAAAGGG - Intergenic
1086828481 11:91529259-91529281 ACACACAGACTGAAAATAAAGGG + Intergenic
1086847624 11:91771582-91771604 ACATATAGACTGAAAATAAAGGG - Intergenic
1087124659 11:94612409-94612431 ACACATAGATTGAAAGTAAAAGG - Intronic
1087227644 11:95620098-95620120 ACATATAGACTGAAAGTAAAGGG + Intergenic
1087344634 11:96955965-96955987 ACTCAAAGCCTTAAGGTAAATGG + Intergenic
1087350311 11:97022840-97022862 ACACATAGACTGAAAATAAAGGG + Intergenic
1087367982 11:97246027-97246049 AGACATAGACTGAAATTAAAGGG - Intergenic
1087460735 11:98443330-98443352 ACACACAGACTGAACATAAAAGG - Intergenic
1087485071 11:98750129-98750151 ACACATAGGCTGAAAATAAAGGG + Intergenic
1087532645 11:99404221-99404243 ACACATAGTCTGAAAATAAACGG - Intronic
1087676074 11:101163513-101163535 ACTTATAGACTGAAAGTAAAGGG - Intergenic
1087690464 11:101315662-101315684 ACATATAGACTGAAAATAAAGGG - Intergenic
1087720650 11:101661698-101661720 ACACACAGACTGAAAATAAATGG - Intronic
1087866013 11:103228049-103228071 TCTCATAAACTTAAGGTAAAGGG - Intronic
1088182109 11:107124186-107124208 ACACACAGACTGAAAATAAAGGG + Intergenic
1088414442 11:109573176-109573198 ACACATAGACTCAAAATAAAAGG + Intergenic
1088444106 11:109904262-109904284 ACACCCAGGCTGAAGCTAAAGGG + Intergenic
1088985462 11:114902393-114902415 ACATATAGACTGAAAATAAAGGG + Intergenic
1089544731 11:119214771-119214793 GTTAATAAACTGAAGCTAAAAGG - Intronic
1089569928 11:119399237-119399259 ACACATAGACTGAAAGTGAAGGG + Intergenic
1089816370 11:121179885-121179907 ACACATAGACTGAAAGTAATGGG - Intronic
1090545254 11:127758531-127758553 ACACATAGGCTCAAGATAAAGGG - Intergenic
1091620693 12:2086309-2086331 AATCATAGAGTAATGCTAAAAGG - Intronic
1092060248 12:5544754-5544776 TCACATAGACTTAAGGTAAAAGG + Intronic
1092398332 12:8148284-8148306 ACACATAGACTCAAAATAAAAGG + Intronic
1092637052 12:10463049-10463071 ACTCATAGGCTCAAAATAAAGGG - Intergenic
1092642663 12:10533126-10533148 ACACAAAGACTGAAAATAAAGGG + Intergenic
1093023891 12:14229082-14229104 ACACATAGACTGAAAGTGAAGGG - Intergenic
1093124509 12:15312745-15312767 ACATATAGACTGAAAATAAAGGG - Intronic
1093414113 12:18900649-18900671 ATTCAAGGACTGAGGCTAAACGG + Intergenic
1093416610 12:18927777-18927799 ACTCAAATCCTGCAGCTAAAAGG + Intergenic
1093581425 12:20787987-20788009 ACACATAGATTGAAAATAAAAGG - Intergenic
1093599562 12:21004968-21004990 ACACATAGGCTCAAACTAAAGGG + Intergenic
1093617451 12:21243777-21243799 ACACATAGACTAAAAATAAAGGG + Intergenic
1093659756 12:21741976-21741998 ACACATAGGCTGAAACTGAAAGG - Intronic
1093903062 12:24658573-24658595 ATACATAGACTGAAAATAAAGGG - Intergenic
1094258818 12:28467242-28467264 ACACATAGACTGAAGAAAAAGGG + Intronic
1094328187 12:29262923-29262945 ACACATAAACTGAAAATAAAGGG + Intronic
1094559483 12:31537760-31537782 ACACATAGACTGAAAATAAAAGG + Intronic
1095259275 12:40080258-40080280 ACTCATAGGCTCAAAGTAAAGGG - Intronic
1095573359 12:43707176-43707198 ACACATAGACTGAAAATAAAAGG - Intergenic
1095611957 12:44139274-44139296 ACTAATAGACTGAAGTGAACTGG + Intronic
1095776325 12:46013934-46013956 ACACATAAACTGAAGGTGAAAGG - Intergenic
1096015848 12:48273988-48274010 ACACATAGACTCAAAATAAAGGG - Intergenic
1096956642 12:55532913-55532935 TCACATAAACTGAAGGTAAAGGG + Intergenic
1097146748 12:56946089-56946111 AAACATAGACTGAAAATAAAGGG - Intergenic
1097477756 12:60079993-60080015 ACACATAGACTGAACGTGAAGGG + Intergenic
1097530658 12:60795795-60795817 ACACATAGGCTCAAACTAAAGGG - Intergenic
1097749792 12:63339129-63339151 ACACATAGACTCAAAATAAAGGG + Intergenic
1097791487 12:63820327-63820349 ACACATAGACTGAAAATAAAGGG + Intergenic
1097898266 12:64848248-64848270 ACACATAGACTGAAAATGAAGGG - Intronic
1097977602 12:65704798-65704820 ACACATAGACTGAAAATGAAAGG - Intergenic
1098054305 12:66487756-66487778 ACACGTAGACTGAAAATAAAGGG + Intronic
1098136282 12:67405810-67405832 ACACATAGGCTGAAAATAAAGGG + Intergenic
1098142636 12:67466540-67466562 ACACACAGACTGAAAATAAATGG - Intergenic
1098333480 12:69378225-69378247 ACACGTAGACTGAAAATAAAGGG - Intronic
1098343479 12:69475443-69475465 TCATTTAGACTGAAGCTAAATGG - Intronic
1098396195 12:70019577-70019599 ACACATAGACTGAAAACAAATGG + Intergenic
1098500797 12:71189332-71189354 TCACATAAACTGAAGGTAAAGGG + Intronic
1098504159 12:71229561-71229583 ATACATAGACTGAAAATAAAGGG + Intronic
1098582696 12:72119889-72119911 ACACATAAACTGAAAATAAAAGG - Intronic
1098672618 12:73250358-73250380 ACACATAGACTGAATGTGAAGGG + Intergenic
1098702733 12:73649143-73649165 ACACATAGACTGAAAATAAAAGG + Intergenic
1098764317 12:74467383-74467405 ACACATAGACTCAAAATAAAGGG - Intergenic
1098939026 12:76513799-76513821 ACTCATAGGCTCAAAATAAAGGG - Intronic
1098993685 12:77094315-77094337 ACACATAGACTCAAAATAAAGGG - Intergenic
1099100716 12:78437124-78437146 ATACATAGACTGAAAATAAAGGG - Intergenic
1099314483 12:81066849-81066871 ACACATAGACTCAAAATAAAGGG + Intronic
1099344328 12:81479295-81479317 ACACATAGGCTGAAAATAAAGGG - Intronic
1099431613 12:82592586-82592608 ACTCATATATGAAAGCTAAAGGG - Intergenic
1099465330 12:82979048-82979070 ACACATAGACTGAAAATAAAGGG - Intronic
1099519270 12:83640382-83640404 ACATATAGACTGAAAATAAAGGG - Intergenic
1099522736 12:83683810-83683832 ACACATACACTGAAAATAAAAGG + Intergenic
1099587796 12:84543846-84543868 ACACATGGACTGAAAGTAAAGGG - Intergenic
1099726642 12:86438749-86438771 TCCTATAGACTCAAGCTAAAGGG + Intronic
1099797581 12:87419018-87419040 ACACATAGACTCAATATAAAGGG - Intergenic
1099911870 12:88844168-88844190 ACATATAGACTGAAAATAAAGGG + Intergenic
1100060782 12:90573180-90573202 ATGCATAGACTGAAAATAAAGGG - Intergenic
1100360538 12:93875264-93875286 ACACATAGACTGAAAATAAAAGG - Intronic
1100420768 12:94430886-94430908 ACACATAGACTGAAAGTAAAGGG + Intronic
1100470131 12:94884003-94884025 ACACATAGACTCAAAATAAAGGG + Intergenic
1100750654 12:97695176-97695198 ACACATAGGCTCAAACTAAAGGG - Intergenic
1100875973 12:98962208-98962230 ACACATAGACTGAAAATAAAGGG + Intronic
1100914645 12:99405815-99405837 ACACATAGACTGAAAATAAGGGG + Intronic
1100923696 12:99519589-99519611 ACAAATAGACTGAAAATAAAAGG - Intronic
1101226937 12:102697382-102697404 ACACATAGACTGAAAGTAAAGGG + Intergenic
1101562514 12:105871307-105871329 ACACAAAGACTGAAAATAAAGGG + Intergenic
1101607824 12:106261712-106261734 ACATATAGACTGAAAATAAAGGG + Intronic
1102440149 12:112957206-112957228 ACACATAGACTGAAAATAAAGGG - Intronic
1102750324 12:115287257-115287279 ACACATAGACTCAAAATAAAAGG + Intergenic
1103168929 12:118797001-118797023 ACACATACACTGAAAATAAAGGG - Intergenic
1103817122 12:123667350-123667372 ACACATAGACTAAAAATAAAGGG - Intergenic
1104102905 12:125631849-125631871 ACATATAGACTGAAAATAAACGG - Intronic
1104158628 12:126157273-126157295 ACTCATGTGCTGAAGCTACATGG - Intergenic
1104741658 12:131179990-131180012 TCTTATAGACTCAAGGTAAAGGG + Intergenic
1105558754 13:21470887-21470909 GCACATAGACTGAAAATAAAGGG - Intergenic
1105648623 13:22348332-22348354 ACACATAGACTCAAAATAAAGGG + Intergenic
1105688555 13:22812388-22812410 ACTCATTGACAGATGGTAAATGG + Intergenic
1105735269 13:23262279-23262301 TCTCATAGACTCAAGGTTAAGGG + Intronic
1105789292 13:23781727-23781749 ACACATAGACTCAAAATAAAGGG + Intronic
1107211106 13:37855110-37855132 ACACATAGACTGAAAATAAAGGG + Intronic
1107265761 13:38552167-38552189 ACACATAGACTGAAAATAAAGGG - Intergenic
1107551909 13:41484669-41484691 ACACATAGACTGAAAATAAAGGG - Intergenic
1107582671 13:41807983-41808005 ATACATAGACTGAAAATAAAGGG + Intronic
1107807683 13:44170008-44170030 ACACATAGACTGAAAATAAAGGG - Intergenic
1108157957 13:47606503-47606525 ACACATAGACTGAAAGTGAAGGG + Intergenic
1108255704 13:48608831-48608853 ACACATAGACTGAAAATAGAGGG - Intergenic
1108262552 13:48673491-48673513 ACACATAGGCTCAAACTAAAGGG - Intronic
1108858665 13:54826861-54826883 ACACACAGACTGAAAATAAAGGG + Intergenic
1109022511 13:57116526-57116548 ACACATAGACTGAAAATAAGGGG - Intergenic
1109031632 13:57197882-57197904 ACACAGAGACTGAAAATAAATGG - Intergenic
1109100469 13:58178333-58178355 ACACATAGCCTGAAAATAAAGGG - Intergenic
1109112517 13:58340007-58340029 ACACATAAACTGAAAATAAAGGG - Intergenic
1109113254 13:58350426-58350448 ACACATAGACTCAAAATAAAGGG - Intergenic
1109317157 13:60763805-60763827 ACTCATAGGCTCAAAATAAAGGG - Intergenic
1109366746 13:61365567-61365589 ACACATAGACTGAAAATAAATGG + Intergenic
1109644837 13:65239900-65239922 ACACATAGACTGAAAGCAAAAGG - Intergenic
1109712978 13:66183263-66183285 AGTCATAGACTGAATATTAAGGG - Intergenic
1109747900 13:66650257-66650279 ACACCTAGACTGAAAATAAAGGG + Intronic
1109766795 13:66910901-66910923 ACACATAGACAGAAACTCAATGG - Intronic
1109824414 13:67698738-67698760 TCTCATAAACTTAAGGTAAAGGG + Intergenic
1109949401 13:69481724-69481746 ACACATAGACTCAAAATAAAGGG - Intergenic
1110180615 13:72612390-72612412 ACACATAGACTCAAAATAAAAGG + Intergenic
1110946167 13:81421277-81421299 TCTTATAGACTCAAGGTAAAGGG - Intergenic
1111130657 13:83970816-83970838 ACTCATAGACTGAAAATAAAGGG + Intergenic
1111389049 13:87567361-87567383 ACTCATAGACTGAAAGCAAAGGG + Intergenic
1111638728 13:90940118-90940140 ACTCAGAGAGTGAAGCAAAAAGG - Intergenic
1111752291 13:92348244-92348266 ACACACAGACTGAAAATAAAGGG + Intronic
1111786411 13:92792658-92792680 ACACATAGACTCAAAATAAAGGG + Intronic
1112053409 13:95667726-95667748 ACATATAGACTGAAAATAAAGGG - Intergenic
1112177186 13:97037564-97037586 ACACATAGACTAAAAATAAAGGG + Intergenic
1112231830 13:97595478-97595500 ACACATAGACTCAAAATAAAGGG + Intergenic
1112618581 13:101031807-101031829 ACACACAGACTGAAAATAAAGGG - Intergenic
1112658325 13:101476626-101476648 ACAAATAGACTGAAAATAAAGGG + Intronic
1113570517 13:111352348-111352370 AGACATAGACTGAAAGTAAAGGG + Intergenic
1113746428 13:112748235-112748257 ATTTATAGACAGAAGCTAGAAGG + Intronic
1114288058 14:21264247-21264269 AGTAATAGACTGAAGGTGAATGG + Intronic
1114687808 14:24551079-24551101 ACACATAGACTGAAAATTAAGGG - Intergenic
1114751358 14:25208405-25208427 ACACATAGACTCAAAATAAAAGG - Intergenic
1114783499 14:25567730-25567752 ACACACAGACTGAAAATAAAGGG - Intergenic
1114792246 14:25672643-25672665 ACTAATATACTTGAGCTAAAGGG + Intergenic
1114983146 14:28190576-28190598 ACACATAGGCTGAAAATAAAAGG + Intergenic
1115134131 14:30088912-30088934 ACACATAGACTGAAAATAACGGG + Intronic
1115276004 14:31609199-31609221 ACACATAGACTGAAAATAAAGGG + Intronic
1115329333 14:32178219-32178241 AGACACAGACTGAAGGTAAAGGG - Intergenic
1115381308 14:32743231-32743253 ACACATAGACTGAAAGTATAGGG - Intronic
1115476966 14:33824510-33824532 ACACATAGACTGAAAATAAAGGG + Intergenic
1115538657 14:34397867-34397889 ACACATAGACTGAAAATGAAGGG + Intronic
1115709493 14:36034736-36034758 ACACATAGACTGAAATTGAAGGG - Intergenic
1115841684 14:37478689-37478711 ACACATAGACTGAAAGTGAAAGG + Intronic
1115861436 14:37690504-37690526 ACACATAGACTGAAAATACAGGG + Intronic
1115948948 14:38697515-38697537 ACCCATAGACTGAAAATGAAGGG + Intergenic
1116045986 14:39742949-39742971 ACACATATACTGAAAATAAAGGG - Intergenic
1116140645 14:40989753-40989775 ACACATAGACTGCAAATAAATGG - Intergenic
1116276766 14:42844307-42844329 ACACATAGACTAAAAATAAAGGG - Intergenic
1116377144 14:44217464-44217486 ACACATAGGCTGAAAATAAAGGG + Intergenic
1116450420 14:45058611-45058633 ACACATAGACTAAAATTAAAGGG - Intronic
1116481435 14:45395626-45395648 ACACATAGATGGAAACTAAAGGG + Intergenic
1116659952 14:47697492-47697514 ACCCATAGACTCAAAGTAAAGGG + Intergenic
1116671527 14:47848206-47848228 ACACATAGACTGAAAACAAAGGG + Intergenic
1116930448 14:50685451-50685473 ACACATAGACTGAAAATAAAGGG - Intergenic
1117264359 14:54071443-54071465 ACACATAGATTGAAAATAAAGGG - Intergenic
1117280536 14:54236136-54236158 ACACATAGACTCAAAATAAAAGG + Intergenic
1117510383 14:56445693-56445715 ACACATAGGCTGAAAATAAAAGG - Intergenic
1117634543 14:57728248-57728270 ACACACAGACTGAAAATAAAGGG - Intronic
1120237952 14:81914629-81914651 ACATATAGACTGAAAATAAAGGG - Intergenic
1120271980 14:82324414-82324436 ACACATAGACTAAAAGTAAATGG - Intergenic
1120559437 14:85972903-85972925 ACACATAGACTCAAAATAAAAGG - Intergenic
1120572291 14:86135383-86135405 ACAAATAGACTGAAAGTAAAAGG + Intergenic
1120620278 14:86754285-86754307 ACACATAGACTGAAAATAAAGGG - Intergenic
1120626557 14:86833847-86833869 ACATATAGACTGAAAGTAAAGGG + Intergenic
1120677090 14:87433279-87433301 AGTCACAGACTGAAGGTTAATGG + Intergenic
1121130620 14:91442803-91442825 ACACACAGACTGAAAATAAAGGG + Intergenic
1121707027 14:96004217-96004239 ACTCATAGGCTCAAAATAAAGGG + Intergenic
1121751238 14:96359060-96359082 ATTCTTAAACTGAAGTTAAAAGG + Intronic
1121758821 14:96425875-96425897 ACACATAGACTGAAAATAAAGGG - Intronic
1122435849 14:101697105-101697127 ACATATAGACTGAAAATAAAGGG + Intergenic
1123013149 14:105358858-105358880 ACTCATAGAGAGAAACTAAAGGG - Intronic
1123111804 14:105874069-105874091 ACACATAGACTGAAAACAAAGGG - Intergenic
1123572069 15:21623407-21623429 ACACATAGACTAAAAGTAAAGGG - Intergenic
1123608685 15:22065994-22066016 ACACATAGACTAAAAGTAAAGGG - Intergenic
1123954428 15:25320118-25320140 ACACATAGACTGAAAGTGAAGGG - Intergenic
1124081146 15:26498778-26498800 ACACATAGAATGAAAATAAAAGG - Intergenic
1124123920 15:26918813-26918835 ACACATAGACTGAAAATGAAGGG - Intronic
1125055169 15:35351263-35351285 ACACATAGACTGAAAGTGAAAGG - Intronic
1125274367 15:37975604-37975626 ACCCATAGACTTAAAGTAAAGGG - Intergenic
1125329770 15:38571476-38571498 ACACATAGACTCAAAATAAAGGG - Intergenic
1125373509 15:39003088-39003110 ACACATAGACTCAAAATAAAAGG + Intergenic
1125980194 15:43993942-43993964 ACACATAGATTGAAAGTAAAAGG - Intronic
1126015847 15:44349279-44349301 ACACAAAGACTGAAAATAAAGGG + Intronic
1126216479 15:46160483-46160505 ACACATAGGCTGAAAATAAAGGG + Intergenic
1126250549 15:46563090-46563112 ACACATAGACTGAAAATAAAGGG - Intergenic
1126278199 15:46909818-46909840 ACTCATAGGCTCAAAGTAAACGG + Intergenic
1126420274 15:48465114-48465136 ACTCATAGCATAAAGCCAAAGGG + Intronic
1126440848 15:48686480-48686502 ACACACAGACTGAAAATAAAGGG + Intergenic
1126476545 15:49070831-49070853 ACACATAGGCTCAAACTAAAGGG + Intergenic
1126512712 15:49498744-49498766 ACCCATAGACTCAAAATAAAGGG + Intronic
1126660438 15:51027842-51027864 ACACATAGACTGAAAATAAAGGG - Intergenic
1126667680 15:51089939-51089961 ACTGACAGATTGAAGATAAATGG - Intronic
1126709197 15:51438601-51438623 ACACATAGACTGAAACCAAAGGG - Intergenic
1126996257 15:54448643-54448665 ACACATAGGCTGAAAATAAAAGG - Intronic
1126997238 15:54458763-54458785 ACACATAAACTTAAGGTAAAGGG - Intronic
1127012690 15:54647352-54647374 ACACATAGACTGAAAATAAAGGG + Intergenic
1127024126 15:54783640-54783662 ACACATAGACTCAAAATAAAGGG + Intergenic
1127188177 15:56502276-56502298 ACACATAGACTGAAAGTAAAGGG + Intergenic
1127191831 15:56539468-56539490 TCTCAGAGACTGAGGCTAAGAGG - Intergenic
1127240573 15:57109121-57109143 ACTGACACACTGAAGCAAAAAGG - Intronic
1127325475 15:57890575-57890597 ACTCAGAGACTGAAGCAGAATGG - Intergenic
1127348693 15:58127867-58127889 ACACATAGGCTGAAAATAAAAGG + Intronic
1127524815 15:59782536-59782558 ACACATAGGCTGAAAATAAAGGG - Intergenic
1127527274 15:59805607-59805629 ACACATAGGCTGAAAATAAAGGG + Intergenic
1127970616 15:63957280-63957302 ACACATAGACTAAAAGTAAAGGG - Intronic
1128364743 15:66990722-66990744 ACACATAGACTGAAAATAAAGGG + Intergenic
1128900757 15:71420335-71420357 ACACATAGACTGAAAATAAAGGG - Intronic
1129070809 15:72949180-72949202 ACATATAGACTGAAAGTAAATGG + Intergenic
1129091376 15:73154714-73154736 ACACATAGACTGAAAGTAAAAGG - Intronic
1129561996 15:76579797-76579819 ACACACAGACTGAAAATAAAGGG + Intronic
1129971627 15:79782611-79782633 ACACATAGGCTGAAAATAAAGGG + Intergenic
1130315778 15:82795163-82795185 ACAAATAGATTGAAACTAAAAGG - Intronic
1130365884 15:83238392-83238414 ATACATAGACTGAAAGTAAAGGG + Intergenic
1130440882 15:83952990-83953012 ACACATAGACTGAAAATAAAGGG - Intronic
1130734132 15:86530231-86530253 ACACATAGGCTGAAAATAAAAGG + Intronic
1131591100 15:93748966-93748988 ACACATAGGCTGAAAATAAAGGG + Intergenic
1131725743 15:95222097-95222119 ACACATAGACTGAAAGTGAAGGG - Intergenic
1131828512 15:96339461-96339483 TCTCACAGACTGAAGGTAAAGGG - Exonic
1131918591 15:97298370-97298392 ACACATAGGCTGAAAATAAAGGG - Intergenic
1132007917 15:98247499-98247521 ACTCACAGGCTCAAGGTAAAGGG - Intergenic
1202980926 15_KI270727v1_random:357793-357815 ACACATAGACTAAAAGTAAAGGG - Intergenic
1133843585 16:9433305-9433327 ACACATAGACTAAAAATAAAGGG - Intergenic
1136770942 16:32840551-32840573 ACACATAGACTCAAAATAAAGGG - Intergenic
1136946546 16:34658693-34658715 ACTCATTGAATGAAACTGAATGG - Intergenic
1137082131 16:36074057-36074079 ACACATAGACTCAAAATAAAAGG + Intergenic
1137418572 16:48310164-48310186 ACACACAGACTGAAGGTAAAGGG - Intronic
1137437047 16:48464089-48464111 ACTCATAGGCTCAAAATAAAGGG - Intergenic
1138864887 16:60805367-60805389 ACACACAGACTGAAAATAAAGGG + Intergenic
1138976266 16:62212289-62212311 ACACATAGACTCAAAATAAAGGG - Intergenic
1140997372 16:80274281-80274303 ACTCACATACTGAAGCAAAAGGG + Intergenic
1142453489 16:90200271-90200293 ACACAGAGACTGAAGCTTGAAGG + Intergenic
1203073365 16_KI270728v1_random:1102664-1102686 ACACATAGACTCAAAATAAAGGG - Intergenic
1142919879 17:3175416-3175438 ACACAGAGACTGAAAATAAAGGG + Intergenic
1142937638 17:3349304-3349326 ACACATAGACTCAAAATAAAAGG + Intergenic
1143413955 17:6731826-6731848 ACACATAGACTGAAAATAAAGGG + Intergenic
1144746553 17:17619360-17619382 ACATATAGACTAAAGTTAAAAGG + Intergenic
1145690889 17:26737963-26737985 ACACATAGACTCAAAATAAAGGG + Intergenic
1146215571 17:30976805-30976827 ACATATAGACTGAAAATAAAGGG - Intronic
1148168098 17:45497898-45497920 AATCAAAGACTGAAGCTACTAGG - Intergenic
1148280718 17:46345062-46345084 AATCAAAGACTGAAGCTACTAGG + Intronic
1148302946 17:46562997-46563019 AATCAAAGACTGAAGCTACTAGG + Intronic
1148811323 17:50293548-50293570 ACACATAGACTGAAAGTTAAGGG + Intergenic
1149159880 17:53679488-53679510 ATACATAGGCTGAAGCTGAAAGG - Intergenic
1149377718 17:56062605-56062627 ACTCATAGGCTCAAAATAAAGGG - Intergenic
1149481183 17:57004373-57004395 ACAAATAGACTTAATCTAAAGGG + Intronic
1149949133 17:60966191-60966213 ACACATAGACTGAAAGTGAAGGG - Intronic
1150399282 17:64844314-64844336 AATCAAAGACTGAAGCTACTAGG - Intergenic
1150444736 17:65220122-65220144 ACTCTAAGACTGAAGCTACTAGG - Intronic
1151114322 17:71716889-71716911 AATCATAGACTGGAGCTAAAGGG - Intergenic
1151393941 17:73807478-73807500 ACACATAGACTCAAAATAAAGGG + Intergenic
1203186255 17_KI270729v1_random:123900-123922 AATCATCGACTGGAGCCAAATGG - Intergenic
1152955576 18:37927-37949 ACACATAGACTCAAAATAAAAGG + Intergenic
1153075068 18:1153443-1153465 ACACTTAGACTGAACATAAAGGG - Intergenic
1153221252 18:2864089-2864111 ACACATAGACTCAAAATAAAGGG - Intronic
1153388632 18:4529730-4529752 ACACATAAACTGAAAATAAAGGG - Intergenic
1153410950 18:4791858-4791880 ACACATAGACTCAAATTAAAGGG + Intergenic
1153425956 18:4963710-4963732 ACACATAGACTAAAAATAAAAGG + Intergenic
1153630394 18:7063810-7063832 ATTCATAGACAAAAGCTGAATGG + Intronic
1153828959 18:8902952-8902974 ACACATATACTTAAGGTAAAGGG + Intergenic
1154061699 18:11067516-11067538 ACACAGAGACTGAAGGTGAAAGG + Intronic
1154386833 18:13900528-13900550 ACACATGGACTGAAAATAAAGGG + Intronic
1155597585 18:27505449-27505471 ACACATAGACTGAATATAAACGG + Intergenic
1155672665 18:28390304-28390326 ACTCATAGGCTCAAAATAAAGGG + Intergenic
1155781848 18:29847421-29847443 ACACATAGACTGAAAATAAATGG - Intergenic
1155842333 18:30660953-30660975 ACACATAGACTCAAAATAAAGGG + Intergenic
1156025757 18:32652870-32652892 ATACATAGACTGAAAATAAAAGG - Intergenic
1156795225 18:41036548-41036570 ACTTAAAGACTGAATCTAGAAGG + Intergenic
1157022047 18:43795320-43795342 ACTGAAAGACTAAAGGTAAAAGG + Intergenic
1157036963 18:43986301-43986323 ACACATGGGCTGAAGATAAAGGG + Intergenic
1157954048 18:52075422-52075444 ACACATAGATTGAAAATAAAAGG - Intergenic
1158153879 18:54403603-54403625 ACACATAGACTCAAAATAAAGGG - Intergenic
1158361234 18:56676234-56676256 ACACATAGACTGAAAATAAAGGG - Intronic
1158431586 18:57392523-57392545 TCTCATAGACTGAAAATAAAGGG + Intergenic
1158631105 18:59114778-59114800 ACACATAGACTCAAAATAAAGGG + Intergenic
1159091780 18:63857883-63857905 ACACATAGACTGAAAATAAAAGG - Intergenic
1159538687 18:69748018-69748040 ACACATAGACTCAAAATAAAAGG + Intronic
1159705761 18:71684651-71684673 ACACATAGACTGAAAATAAAGGG + Intergenic
1159730867 18:72025852-72025874 ACTTATATATTGAAGGTAAAAGG - Intergenic
1160138250 18:76293941-76293963 ACACATAGACGGAAAATAAAGGG - Intergenic
1160623627 18:80188307-80188329 ATTCAAAGACTGAACCTACATGG + Intronic
1162053152 19:8047023-8047045 ACACATAGACTGAAAGTGAAGGG + Intronic
1162245860 19:9399913-9399935 ACACATAGACTCAAAATAAAGGG + Intergenic
1162666471 19:12217448-12217470 ACACACAGACTGAAAATAAAGGG - Intergenic
1163858349 19:19724950-19724972 ACACATAGGCTCAAGATAAAGGG - Intronic
1163914342 19:20227062-20227084 ACACATAGGCTGAAAATAAAGGG - Intergenic
1163975094 19:20843263-20843285 ACACATAGACTCAAAATAAAGGG + Intronic
1164246418 19:23434000-23434022 ACACATAGACTCAAAATAAAAGG - Intergenic
1164265813 19:23615664-23615686 ACACATAGGCTGAAAATAAAGGG + Intronic
1164497419 19:28779643-28779665 ACACATAAACTGAAAGTAAAAGG + Intergenic
1165011240 19:32848309-32848331 ACTCATAGGCTCAAAATAAAGGG + Intronic
1165590075 19:36961386-36961408 ACATATAGACTGAAAGTAAAAGG - Intronic
1165645862 19:37435635-37435657 ACACATAGACTGAAAATAGATGG + Intronic
1165688097 19:37839638-37839660 ACACATAGGCTGAAAATAAAAGG + Intergenic
1166408011 19:42536663-42536685 ACACATAGACTGAAATTAAAGGG - Intronic
1167027924 19:46935118-46935140 CCTTATAGACTGAAGCAAACAGG - Intronic
1168189948 19:54730679-54730701 ACTCATATGCAGGAGCTAAAAGG - Intronic
1168194233 19:54761600-54761622 ACCCATATACAGGAGCTAAAAGG - Intronic
1168196280 19:54776332-54776354 ACCCATATACAGGAGCTAAAAGG - Intronic
1168204642 19:54840576-54840598 ACCCATATACAGGAGCTAAAAGG - Intronic
1168369067 19:55816168-55816190 ACACATAGACTGAAAATAAGAGG + Intronic
1168449263 19:56451107-56451129 ACACATAGACTAAAAATAAAGGG + Intronic
1202670538 1_KI270709v1_random:46047-46069 ACACATAGACTCAAAATAAAGGG + Intergenic
1202673819 1_KI270710v1_random:22195-22217 ACACATAGACTCAAAATAAAGGG - Intergenic
925012773 2:498029-498051 GCCCATAGAATGAAGCTCAATGG - Intergenic
925269674 2:2594178-2594200 ATACATAGACTGAAAATAAAGGG + Intergenic
925322014 2:2978733-2978755 ACAGATAGACTGAAAGTAAAGGG + Intergenic
925491003 2:4392792-4392814 ACACATAGACTGAAAATAAAGGG - Intergenic
926454107 2:13042558-13042580 ACACATAGACTCAAAATAAAAGG + Intergenic
926496132 2:13591117-13591139 ACCCATAGGCTCAAACTAAAGGG - Intergenic
927309552 2:21614885-21614907 ACACATAGACTGAAAATGAAAGG - Intergenic
927348150 2:22071522-22071544 ACACATAGACTGAAAATAAAGGG + Intergenic
928250139 2:29669462-29669484 ACACATAGACTGAAAGTGAAGGG - Intronic
928477059 2:31638779-31638801 ACACATAGGCTGAAAGTAAAAGG - Intergenic
928629127 2:33172276-33172298 ACACATAGACTCAAAATAAAAGG + Intronic
928843056 2:35633995-35634017 ACTCACAGACGGATGCTGAAAGG + Intergenic
928850248 2:35736412-35736434 ACACATAGGCTCAAGATAAATGG + Intergenic
928932735 2:36640921-36640943 ACACATAGACTGAAAATAAAGGG + Intronic
929146986 2:38715227-38715249 ACACATAGACTGAAAGTGAAGGG - Intronic
929649509 2:43664342-43664364 ACACATAGGCTGAAAATAAAAGG - Intronic
930141810 2:47958602-47958624 ACACATAGACTGAAAATAAAGGG + Intergenic
930216773 2:48705762-48705784 ACACATAGGCTCAAACTAAAGGG - Intronic
930252964 2:49056261-49056283 ACACATAGACTGAAATTGAAAGG + Intronic
930527737 2:52551206-52551228 ACACATAGACCGAAAATAAAGGG + Intergenic
930727700 2:54698194-54698216 ACACATAAACTGAAGACAAAGGG + Intergenic
930803260 2:55464415-55464437 ACACATAGACTCAAAATAAAGGG + Intergenic
930839977 2:55835392-55835414 ACACATAGGCTGAAAATAAAGGG - Intergenic
930893909 2:56423310-56423332 ACACATAGACTCAAAATAAAGGG + Intergenic
930895174 2:56437674-56437696 ACACATGGACTGAAAATAAAGGG - Intergenic
930935430 2:56944269-56944291 ACACATAGACTAAAAATAAAGGG - Intergenic
930948163 2:57101831-57101853 ACACATAGACTGACAATAAAGGG - Intergenic
930970425 2:57388415-57388437 ACACATAGACTGAAAATAAAGGG + Intergenic
930972378 2:57411438-57411460 ACACATAGACTAAAAATAAAGGG + Intergenic
931161684 2:59699478-59699500 ACGCATAGACTAAAAATAAAGGG - Intergenic
931530877 2:63212740-63212762 ACACATAGCCTGAAAATAAAGGG + Intronic
931534917 2:63264248-63264270 ACACACAGACTGAAAGTAAATGG + Intronic
931543630 2:63356050-63356072 ACTCATAGGCTCAAAATAAAGGG + Intronic
931568774 2:63645867-63645889 ACACATAGACTGAATGTAAAGGG - Intronic
931572486 2:63683371-63683393 GCACATAGACTGAAAATAAAGGG + Intronic
931932100 2:67150153-67150175 ACACATAGACTGAAAATAAAGGG + Intergenic
932371875 2:71196882-71196904 ACTCATAGGCTCAAAATAAAGGG - Intronic
932482928 2:72059408-72059430 ACCCATAGACTCAAAATAAAGGG - Intergenic
932669407 2:73723668-73723690 ACACATAGACTCAAAATAAAAGG + Intergenic
932914103 2:75836250-75836272 ACACATAGACTCAAAATAAAGGG + Intergenic
932931541 2:76045852-76045874 ACACATAGACTAAAACTAAAGGG + Intergenic
932933436 2:76072263-76072285 ACACAGAGACTGAAAGTAAAGGG + Intergenic
933096832 2:78194314-78194336 ACACATAGACTGAACATAAAGGG + Intergenic
933403714 2:81831061-81831083 ACTTACAGACTGAAGGTGAAGGG + Intergenic
933988875 2:87618443-87618465 ACACATAGACAGAAACTGAAGGG + Intergenic
934623011 2:95827098-95827120 ACTCATCGTCTCAAACTAAAAGG - Intergenic
934802281 2:97176494-97176516 ACACATAGACTCAAAATAAAAGG - Intronic
934806234 2:97229506-97229528 ACACATAGACTCAAAATAAAAGG - Intronic
934810756 2:97274990-97275012 ACTCATCGTCTCAAACTAAAAGG + Intergenic
934826936 2:97432949-97432971 ACTCATCGTCTCAAACTAAAAGG - Intergenic
935369198 2:102326625-102326647 ACACATAGACTCAAAATAAAGGG + Intronic
935393278 2:102577648-102577670 ACACACAGACTGAAAATAAAGGG - Intergenic
935989874 2:108709549-108709571 ACACATAGATTGAAAATAAAGGG + Intergenic
936063093 2:109309624-109309646 ACACATAGGCTGAAAATAAAAGG + Intronic
936304969 2:111332384-111332406 ACACATAGACAGAAACTGAAGGG - Intergenic
936640717 2:114309537-114309559 ACACATAAACTGAAAATAAAGGG - Intergenic
936673975 2:114692946-114692968 ACACATAGACTTAAAATAAAGGG - Intronic
936794731 2:116191342-116191364 ACACATAGACTAAAAATAAAGGG - Intergenic
936825174 2:116573374-116573396 GCACATAGACTGAAAATAAAGGG - Intergenic
937172568 2:119890378-119890400 ACATATAGACTGAAAATAAAGGG - Intronic
937397401 2:121549211-121549233 ACCCATAGGCTCAAACTAAATGG + Intronic
937560824 2:123221907-123221929 ACACACAGACTGAAAATAAAGGG + Intergenic
937610752 2:123857729-123857751 ACACATAGGCTCAAGATAAAGGG + Intergenic
937730086 2:125219951-125219973 ACACATAGACTGAAAGTAAAGGG - Intergenic
937805770 2:126142770-126142792 ACACATATACTGAAAATAAAAGG - Intergenic
937848140 2:126604193-126604215 ACCCATAGGCTCAAGATAAAAGG + Intergenic
938175565 2:129124145-129124167 TCTTATAGACTCAAGGTAAAGGG - Intergenic
939033501 2:137103654-137103676 ACACATAGGCTGAAAATAAAGGG + Intronic
939236350 2:139499020-139499042 ACTCATAGGCTCAAAATAAAAGG + Intergenic
939244573 2:139607339-139607361 ACACATAGACAGAAAATAAAGGG - Intergenic
939470186 2:142611654-142611676 ACACATAGACTCAAAATAAAAGG - Intergenic
939807429 2:146790679-146790701 ACACATAGACTCAAAATAAAAGG + Intergenic
940184932 2:150973385-150973407 ACACATATGCTGAAGTTAAAAGG - Intergenic
940503499 2:154524632-154524654 ACACACAGACTGAAAATAAAGGG - Intergenic
940820836 2:158353349-158353371 ACACATAGGCTGAAAATAAAAGG + Intronic
940836217 2:158524755-158524777 ACACATAGGCTGAAAATAAAAGG + Intronic
940948007 2:159639979-159640001 ACACATAGACTGAAAATAAAGGG + Intergenic
941560106 2:167034566-167034588 ACACATAGACTGAAAATAAAGGG + Intronic
941672248 2:168307488-168307510 AAACATAGACTGAAAATAAAGGG - Intergenic
941749863 2:169123202-169123224 ACATATAGACTGAAAGTAAAGGG + Intergenic
941861835 2:170290545-170290567 ACACATAGACTGAAAATGAAGGG - Intronic
942391546 2:175499923-175499945 GCACATAGACTGAAAATAAAGGG - Intergenic
942750464 2:179280730-179280752 ACACACAGACTGAAAATAAAGGG + Intergenic
942838464 2:180330290-180330312 ACACATAGACTGAAAATAAAGGG + Intergenic
942915239 2:181297170-181297192 ACATATAGACTGAAAATAAAGGG + Intergenic
942972029 2:181968558-181968580 ACACATAGACTGAAAATAAAGGG - Intronic
942975476 2:182012473-182012495 ACACATAGACTGAACATAAAGGG - Intronic
943100731 2:183482775-183482797 AGACATAGACTGAAAATAAAGGG - Intergenic
943170355 2:184389596-184389618 ACACATAGATTGAAAATAAAGGG + Intergenic
943357854 2:186880534-186880556 ACACATAGGCTGAAAATAAAAGG - Intergenic
943650426 2:190451949-190451971 ACTCAGAGAATGAAGAAAAATGG - Intronic
943880354 2:193136677-193136699 ACACATAGAATAAAGGTAAAAGG + Intergenic
943923539 2:193741051-193741073 ACACATAGACTGAAAATAAAGGG + Intergenic
943957033 2:194205753-194205775 ACCCACAGACTCAAGATAAAGGG - Intergenic
944018311 2:195071392-195071414 ACACATAGACTCAAAATAAAAGG - Intergenic
944048773 2:195442584-195442606 ACACATAGACTGAAAATACAGGG + Intergenic
944077281 2:195746120-195746142 ACACATAGGCTCAAGATAAAAGG + Intronic
944078888 2:195762508-195762530 ACATATAGACTGAAAATAAAAGG + Intronic
944095807 2:195966809-195966831 ACACATAGACTGAAAATAAAAGG - Intronic
944377239 2:199060287-199060309 ACACATAGACTGAAAATAAAGGG + Intergenic
944935887 2:204567402-204567424 ATTCATAGACAGAAAGTAAATGG - Intronic
945116561 2:206413927-206413949 ACACATAGGCTGAAAATAAAGGG - Intergenic
945390880 2:209263643-209263665 ACACATAGACTCAAAATAAAGGG + Intergenic
945392695 2:209283952-209283974 ACACATAGACTCAAAATAAAGGG - Intergenic
945481337 2:210349419-210349441 ACACATAGGCTCAAGATAAAGGG - Intergenic
945524202 2:210867903-210867925 ACACATAGACTCAAAATAAAAGG + Intergenic
945572385 2:211484996-211485018 GAACATAGTCTGAAGCTAAAAGG + Intronic
945738657 2:213633889-213633911 ACACATAAACTGAAAATAAAGGG - Intronic
946610925 2:221456864-221456886 ACTCAGAAACTGAAAGTAAATGG + Intronic
946975483 2:225144280-225144302 ACACATAGACTAAAAGTAAAGGG + Intergenic
947179060 2:227396160-227396182 TCTCAAGGACTGAAGCAAAAGGG + Intergenic
947238414 2:227968596-227968618 ACACATAGACTCAAAATAAAGGG - Intergenic
947738344 2:232471512-232471534 ACTCATAGACTGAAAGTGAAAGG - Intergenic
948475220 2:238213867-238213889 ACACATAGACTGAAAATAAAAGG - Intergenic
948680227 2:239628694-239628716 ACAAAAAGACTGGAGCTAAATGG - Intergenic
949084933 2:242144920-242144942 ACACAGAGACTGAAGCTTGAAGG + Intergenic
1168736006 20:137402-137424 ACACATAGACTGATAATAAAGGG + Intergenic
1168945470 20:1752014-1752036 ACACATAGATTGAAACTGAAGGG + Intergenic
1169319758 20:4622869-4622891 ACACATAGGCTCAAACTAAAAGG - Intergenic
1169617691 20:7468586-7468608 ACACATAGACTGAAAACAAAGGG - Intergenic
1169628925 20:7603285-7603307 ACATATAGACTGAAAATAAAGGG + Intergenic
1169671952 20:8112757-8112779 ACACATAGGCTGAAAATAAAAGG - Intergenic
1170026647 20:11895798-11895820 GCTCAAAGACTGAGGGTAAAAGG - Intronic
1170062980 20:12278849-12278871 ACACATAGACTGAAAATAAAGGG + Intergenic
1170236304 20:14108542-14108564 ACACATAGACTAAAAATAAAGGG + Intronic
1170496819 20:16932897-16932919 ACACATAGACTCAAAATAAAGGG + Intergenic
1170708946 20:18772381-18772403 ACACATAGACTAAAAATAAAGGG - Intergenic
1170730216 20:18967687-18967709 ACACATAGGCTCAAGATAAAGGG + Intergenic
1171065614 20:22011693-22011715 ACACATAGGCTCAAACTAAAAGG + Intergenic
1171353736 20:24526727-24526749 ACTTAGAGACTTAAACTAAAAGG - Intronic
1171378455 20:24713018-24713040 TCTCATAAACTTAAGGTAAAGGG - Intergenic
1171791310 20:29528033-29528055 ACACATAGACTCAAAATAAAAGG + Intergenic
1171867695 20:30500341-30500363 ACTCACTAAATGAAGCTAAAGGG + Intergenic
1171940625 20:31325531-31325553 ACACATAGACTGAAAATGAAGGG + Intergenic
1173203968 20:40977339-40977361 ACACACAGACTGAAAATAAAGGG - Intergenic
1174580046 20:51564858-51564880 AGTAATAGACTAAAGCTGAAAGG + Intergenic
1174691101 20:52505902-52505924 ACACATAGACTGAAAATAAAGGG + Intergenic
1175570650 20:60018467-60018489 ACACATAGACTGAACATGAAGGG - Intronic
1175631932 20:60547871-60547893 ACACATAGACTGAAAATAAAGGG - Intergenic
1176736339 21:10550358-10550380 ACACATAGACTGATAATAAAGGG + Intronic
1176939595 21:14908543-14908565 ACATATAGACTGAAAATAAAGGG - Intergenic
1176941345 21:14929219-14929241 ACACATAGGCTGAAAATAAAAGG + Intergenic
1177108292 21:16989438-16989460 ACACATAGAATGAAAATAAAGGG - Intergenic
1177133145 21:17281305-17281327 ACACATAGACTAAAAATAAAGGG + Intergenic
1177200341 21:17946764-17946786 ACACATAGACTGAAAGTAAAGGG - Intronic
1177430045 21:20980839-20980861 ACACATAGACTAAAAGTAAAGGG - Intergenic
1177444099 21:21169334-21169356 ACTCATAGAAAGAAGATAACAGG + Intronic
1177474167 21:21597099-21597121 ACTCATAGGCTCAAAGTAAAGGG - Intergenic
1177487880 21:21782862-21782884 ACACATATACTGAAAATAAAGGG - Intergenic
1177494408 21:21871028-21871050 ACACACAGACTGAAAATAAAGGG - Intergenic
1177758633 21:25377189-25377211 ACACATAGATTGAAAGTAAAGGG - Intergenic
1177964419 21:27709969-27709991 ACACATAGACTGAAAACAAAGGG - Intergenic
1177970345 21:27780993-27781015 ACACATAGACTGAAAATAAAGGG + Intergenic
1178212059 21:30546764-30546786 ACACATAGACAGAAAATAAAAGG - Intronic
1179279900 21:39925298-39925320 CCTCACAGACTGAAGTTAAATGG + Intronic
1180570136 22:16707821-16707843 ACTCATACACTTAAGCCATAAGG - Intergenic
1180724226 22:17932743-17932765 GCACATAGGCTGAAGATAAAGGG + Intronic
1182162781 22:28139847-28139869 ACTCAGGCCCTGAAGCTAAAGGG - Intronic
1182790020 22:32943720-32943742 ACACATAGACTCAAAATAAAGGG + Intronic
1183182484 22:36269795-36269817 ACACATAGGCTGAAAATAAAGGG - Intergenic
1183497467 22:38155953-38155975 ACACATAGACTGAAACTAAAGGG + Intronic
1184071063 22:42147293-42147315 ACACATGGACTGAAAATAAAGGG + Intergenic
1184317265 22:43705006-43705028 ATACATAGACTGAAAGTAAAGGG + Intronic
1203236234 22_KI270732v1_random:3989-4011 ACACATAGACTCAAAATAAAGGG + Intergenic
949448249 3:4158846-4158868 ACACACAGACTGAAAATAAAGGG - Intronic
949754106 3:7389718-7389740 ACTCATAGACTCAGAGTAAAGGG - Intronic
949800982 3:7904207-7904229 ACACATAGGCTCAAACTAAAGGG - Intergenic
950292817 3:11800439-11800461 ACAAATAGACTGAAAGTAAAGGG + Intronic
950792466 3:15484083-15484105 ACACATAGGCTCAAGATAAAGGG - Intronic
950848718 3:16041701-16041723 ACTCATAGGCTCAAAGTAAAGGG - Intergenic
950927556 3:16757640-16757662 ACACATAGACTGAAAATAAATGG - Intergenic
951028649 3:17857646-17857668 ACACATAGGCTGAAAATAAAGGG - Intronic
951155829 3:19352009-19352031 ACACATAGACTCAAAATAAAGGG + Intronic
951180889 3:19657086-19657108 ACTCATAGACTCAAAGTCAAGGG + Intergenic
951241627 3:20293086-20293108 ACACATAGACTGAAAGTGAAGGG - Intergenic
951297010 3:20949946-20949968 ACCCATAGACTCAAAATAAAGGG - Intergenic
951404816 3:22282960-22282982 ACTCATAAACTTAAGGTAAAGGG + Intronic
951436733 3:22673852-22673874 ATACATAGACTGAAAATAAAAGG - Intergenic
951676205 3:25245173-25245195 ACTCATAGACTCAAAATAAAGGG - Intronic
952066209 3:29574429-29574451 ACCCACAGACTGAAAATAAAGGG - Intronic
952132396 3:30380739-30380761 ACACAAAGACTGAAAATAAAGGG - Intergenic
952190109 3:31014157-31014179 CCTCATGGACTGCAGTTAAATGG - Intergenic
952222201 3:31334783-31334805 ACACATAGACTGAAAATAAAGGG + Intergenic
952243495 3:31560048-31560070 ACATATAGACTGAAAGTAAAGGG - Intronic
952574769 3:34761088-34761110 ACACATAGACTCAAAATAAAAGG + Intergenic
952676651 3:36039381-36039403 ACACATACACTGAAAGTAAAAGG - Intergenic
952726045 3:36585661-36585683 ACACACAGACTGAAAATAAAGGG + Intergenic
952804115 3:37330610-37330632 ACTCAAAGCCTGAAGCTTGAAGG - Intronic
953074296 3:39553474-39553496 ACTCATAGGCTCAAAATAAAGGG + Intergenic
953087562 3:39685521-39685543 ACACATAGACTGAAAATAAAGGG + Intergenic
953100939 3:39827021-39827043 ACCCATAGACTGAAAGTAAAGGG - Intronic
953104067 3:39858170-39858192 ACACATAGACTGAAAGTGAAAGG + Intronic
953166031 3:40465695-40465717 CCTCATGGACTGTAGCCAAAGGG - Intergenic
953198754 3:40757646-40757668 ACACTTAGACTGAAAATAAAGGG + Intergenic
953217460 3:40933304-40933326 ACACATAGACTGAAAATAAAGGG + Intergenic
953254876 3:41279914-41279936 ACACATAGACTCAAAATAAAGGG + Intronic
953264510 3:41372912-41372934 ACTCATAGGCTCAAAATAAAGGG + Intronic
953554999 3:43938307-43938329 ACACATAGACTCAAAATAAAGGG - Intergenic
954485596 3:50848163-50848185 ACCCATAGGCTCAAGGTAAAGGG - Intronic
954498946 3:50991369-50991391 ACTCATAGGCTCAAAATAAAGGG + Intronic
954506941 3:51084956-51084978 ACACATAGACTGAAAGTGAAGGG + Intronic
955031154 3:55220549-55220571 ACACATAGACTGAAACTAAAGGG - Intergenic
955425075 3:58779290-58779312 ACACATAGACTAAAAATAAAGGG + Intronic
955425159 3:58780566-58780588 ACATATAGACTGAAAATAAAGGG + Intronic
955630095 3:60964301-60964323 ACACATAGGCTCAAACTAAAGGG - Intronic
956371621 3:68569904-68569926 ACACATAGACTAAAAGTAAAGGG - Intergenic
956400013 3:68868125-68868147 ACACATAGACTGAAAGTGAAAGG + Intronic
956476361 3:69624420-69624442 ACAGATAGACTGAAAATAAAGGG + Intergenic
956533748 3:70252353-70252375 AGTCATACACTGAAGCAAATGGG - Intergenic
957161321 3:76612943-76612965 ACATATAGACTGAAAATAAAAGG - Intronic
957441058 3:80248394-80248416 ACTCATAGGCTCAAAATAAACGG + Intergenic
957481271 3:80798891-80798913 ACATATAGACTGAAAGTAAATGG + Intergenic
957745554 3:84337196-84337218 ACACATAGGCTGAAAATAAAGGG - Intergenic
957778846 3:84792413-84792435 ACCCAGAGACTGAAAATAAAGGG + Intergenic
957780598 3:84813640-84813662 ACACATAGACTCAAAATAAAGGG - Intergenic
957907084 3:86570804-86570826 ATTTATAGACTGAAGGTAAAGGG + Intergenic
957907398 3:86575778-86575800 GCACATAGACTGAAAATAAAGGG - Intergenic
957908040 3:86582931-86582953 ACACATAGACTCAAGATAAAGGG + Intergenic
957925690 3:86807712-86807734 ACACATAGACTGAAAATAACAGG + Intergenic
958100924 3:89009053-89009075 ACACATAGACTTAAAATAAAGGG - Intergenic
958191550 3:90191522-90191544 ACACATAGACTAAAAATAAAGGG - Intergenic
958257228 3:91339265-91339287 ACACATAGGCTCAAGATAAAGGG - Intergenic
958262595 3:91399580-91399602 TCTTATAGGCTGAAGATAAATGG - Intergenic
958617772 3:96517376-96517398 ACACATAGACTGAAAAGAAAAGG + Intergenic
958670231 3:97194922-97194944 ACACATAGACTGAAAATAAAGGG - Intronic
958683086 3:97355809-97355831 ACACATAGACTGAAAATAAAGGG + Intronic
958749340 3:98176359-98176381 ACACATAGGCTCAAACTAAAGGG + Intronic
958756632 3:98257383-98257405 ACACATAGACTGAAAACAAAGGG - Intergenic
958769449 3:98408846-98408868 ACACATAGGCTCAAACTAAAGGG + Intergenic
958771476 3:98430775-98430797 GCACATAGATTGAAGGTAAAGGG + Intergenic
958817758 3:98934921-98934943 ACCCATAGACTCAAAGTAAAGGG + Intergenic
958827089 3:99043216-99043238 ACACATAGACTGAAAGTAAAGGG + Intergenic
958976757 3:100676957-100676979 ACACACAGACTGAAAATAAATGG - Intronic
959118260 3:102203578-102203600 ACACACAGACTGAAAATAAAGGG - Intronic
959127746 3:102310662-102310684 ACCCATAGACTAAAAATAAAGGG + Intronic
959304136 3:104638430-104638452 ACAAATAGACTGAAAATAAAGGG + Intergenic
959305046 3:104652250-104652272 ACACATAGACTGTAAGTAAAGGG - Intergenic
959354375 3:105306985-105307007 ACACATAGACTAAAAGTAAAGGG + Intergenic
959464088 3:106664627-106664649 ATACATAGACTGAAGGTGAAGGG + Intergenic
959466662 3:106695825-106695847 CCTCATAATCTGAAGCTACAAGG + Intergenic
959735212 3:109650168-109650190 ACACATAGGCTGAAAATAAAGGG + Intergenic
959825368 3:110788727-110788749 ACTCATAGGCTGAAAGCAAAGGG - Intergenic
960095203 3:113682815-113682837 ACACATAGACTGAAAATAAGGGG - Intronic
960152459 3:114264128-114264150 ACACATAGACTGAAAATAAAGGG - Intergenic
960542549 3:118877695-118877717 ACACACAGACTGAAAATAAAGGG + Intergenic
960566375 3:119136449-119136471 ACACATAGACTGAAAATTAAGGG + Intronic
960568992 3:119166749-119166771 ACACATAGACTCAAAATAAAGGG + Intronic
960870201 3:122240308-122240330 ACACATAGGCTGAAAATAAAGGG + Intronic
961850678 3:129814676-129814698 ACACATAGACTGAAAGTGAAGGG + Intronic
961964122 3:130884866-130884888 ACACATAGGCTGAAAATAAAAGG - Intronic
962015473 3:131434893-131434915 ACACACAGACTAAAACTAAAGGG + Intergenic
962078493 3:132111949-132111971 ACACATAGAGTGAAAATAAAGGG - Intronic
962413103 3:135158576-135158598 ATTCATAGAGTGAAACTGAAAGG - Intronic
962483581 3:135819135-135819157 ACACATAGACTGAAAATAAAGGG + Intergenic
962554235 3:136530012-136530034 ACATACAGACTGAAACTAAAGGG + Intronic
962615257 3:137120144-137120166 ACTAATAGACTGAAGGTAAAGGG - Intergenic
962688620 3:137871433-137871455 ACACATAGAATGAAAATAAAGGG + Intergenic
962774479 3:138646246-138646268 ACACATAGACTGAAAATGAAGGG - Intergenic
962899693 3:139749527-139749549 ACACATAAATTGAAGGTAAAGGG - Intergenic
962918022 3:139924806-139924828 ACTTACAGAATGAAGCTGAATGG - Intergenic
962935722 3:140078801-140078823 ACTCATAAACTTAAAATAAAAGG - Intronic
963310332 3:143702851-143702873 ACACATAGACTGAAAATAAAGGG + Intronic
963515553 3:146303841-146303863 ACACATAGACTGAAAATAAAGGG + Intergenic
963701637 3:148633480-148633502 ACACATATACTGAAAATAAAGGG + Intergenic
963742084 3:149090576-149090598 ACTCATAGACTGAAGAAAGTAGG + Intergenic
963802514 3:149690394-149690416 ACACATAGACTAAAAATAAAGGG + Intronic
963824349 3:149935241-149935263 ACACATAGACTGAAAGTAAAGGG - Intronic
963829943 3:149995755-149995777 ACATATAGACTGAAAATAAAGGG + Intronic
963932081 3:151013683-151013705 TCTCATAGATTTAAGCTCAAAGG + Intergenic
963976545 3:151486075-151486097 ACACATAGGCTCAAACTAAAGGG + Intergenic
963996325 3:151713685-151713707 ACACATAGACTGACAATAAAAGG + Intergenic
964318423 3:155468517-155468539 ACACATAGACTGAAAATAAACGG + Intronic
964325172 3:155537521-155537543 ACTCATAAACTTAAAGTAAAGGG + Intronic
964521036 3:157567253-157567275 ATGCATAGACTGAAAGTAAAAGG - Intronic
964613363 3:158636648-158636670 ACACATAGGCTGAAAATAAAAGG + Intergenic
964804314 3:160590224-160590246 ACACACAGACTGAAAATAAATGG + Intergenic
964919360 3:161877191-161877213 ACCCATAGACTCAAAGTAAAGGG + Intergenic
964964835 3:162479340-162479362 ACACATAGACTCAAAATAAAGGG - Intergenic
965009954 3:163074404-163074426 ACACACAGACTGAAAATAAAGGG + Intergenic
965099821 3:164281201-164281223 ACACATAGACTGAAAATAAAGGG + Intergenic
965100690 3:164293671-164293693 ACACATAGACTCAAAATAAAAGG + Intergenic
965131344 3:164704744-164704766 ACACATAGACTCAAAATAAAAGG + Intergenic
965345346 3:167541825-167541847 ACTCATAAACTTAAGGTAAAGGG + Intronic
965394527 3:168146081-168146103 ACTTACAGACTGAAGATAAAGGG - Intergenic
965442485 3:168731993-168732015 ACACATAGACTGAAAGTGAAGGG + Intergenic
965649677 3:170920299-170920321 ACCCATAGGCTCAAGATAAAGGG + Intergenic
965745618 3:171922055-171922077 ACACATAAACTTAAGGTAAAGGG + Intronic
965940599 3:174175498-174175520 ACATATAGACTGAAAATAAACGG - Intronic
966076640 3:175943286-175943308 ACTTATAGACTGAAGGTGAGGGG + Intergenic
966151445 3:176871636-176871658 ACACATAGACTAAAAGTAAAGGG + Intergenic
966275715 3:178165243-178165265 ACACGTAGACTGAAAATAAAGGG + Intergenic
966312716 3:178612602-178612624 AAACATAGACTGAAAATAAAAGG - Intronic
966477778 3:180369632-180369654 ACGCATAGACTCAAAATAAAGGG + Intergenic
966998156 3:185304980-185305002 ACACATAGACTGAAAGTGAAAGG - Intronic
967435764 3:189444285-189444307 ACACATAGACTCAAAATAAAGGG - Intergenic
967502856 3:190220482-190220504 ACTCATAGGCTCAAAATAAAGGG - Intergenic
967508680 3:190284633-190284655 ATACACAGACTGAAGGTAAAGGG - Intergenic
967551333 3:190799374-190799396 ACACATAGACTGAAAATAAAGGG + Intergenic
967622004 3:191644516-191644538 ACCCATAGGCTCAAGGTAAAGGG + Intergenic
967655758 3:192046311-192046333 ACACAGAGACTGAAAATAAATGG + Intergenic
967656083 3:192051484-192051506 CCTCATATACTGAGGATAAAAGG + Intergenic
967696702 3:192541001-192541023 ACACATAAACTGAAAATAAAGGG - Intronic
967725960 3:192862691-192862713 ACTCATACACTTAAGAGAAAAGG + Intronic
968079047 3:195834029-195834051 ACTCACAGACTGAGGCTCCAGGG - Intergenic
969027368 4:4184164-4184186 ATTCATATATTGAAGCTTAATGG - Intergenic
969033702 4:4233437-4233459 ACACATTAACTGAAGATAAAAGG + Intergenic
969165461 4:5306505-5306527 ACACATAAACTTAAGGTAAAGGG - Intronic
969169737 4:5350764-5350786 ACATATAGACTGAAAGTAAAAGG + Intronic
970070474 4:12153922-12153944 ACACATAGACTGACAATAAAAGG - Intergenic
970170846 4:13288955-13288977 ACTCATAGGCTCAAAATAAAGGG - Intergenic
970185886 4:13453136-13453158 ACACATAGACTGAAAGTGAAAGG - Intronic
970208854 4:13685821-13685843 ACACACAGACTGAATGTAAAGGG - Intergenic
970214308 4:13743266-13743288 ACACATAGACTCAAAATAAAGGG - Intergenic
970362620 4:15324932-15324954 ACTGATACACAGAAGTTAAAAGG - Intergenic
970379009 4:15487506-15487528 GCACATAGACTGAAAATAAAGGG - Intronic
970402112 4:15727158-15727180 ACTCAGAGGCCGAAGCAAAACGG + Intronic
970633895 4:17985630-17985652 ACCCATAGGCTGAAAATAAAAGG - Intronic
970666266 4:18341115-18341137 ACTCATAGGCTCAAAATAAAGGG - Intergenic
971106225 4:23526744-23526766 ACTCATAGACTCAAAATAAAGGG + Intergenic
971703479 4:30010438-30010460 ACAGATAGACTGAAAATAAAGGG - Intergenic
971797469 4:31246553-31246575 ACACATAGACTGAAGGTAAAGGG + Intergenic
971914241 4:32847955-32847977 TTTCATAGACTGAAAATAAAGGG - Intergenic
972014780 4:34230215-34230237 ACACATAGAATGATGATAAAGGG - Intergenic
972063817 4:34913485-34913507 ACACATAGACGGAAGGTAAAGGG + Intergenic
972208066 4:36801776-36801798 ACACATAGACTGAAAATAAAGGG + Intergenic
972215129 4:36889389-36889411 ACTCATAGGCTTAAAATAAAGGG - Intergenic
972269861 4:37500982-37501004 ACTCATAGGCTCAAAATAAAGGG - Intronic
972909808 4:43800497-43800519 ACGCACAGACTGAAAATAAAGGG + Intergenic
972928663 4:44043327-44043349 ACACATAGATTGAAAATAAAGGG + Intergenic
973013658 4:45108992-45109014 ACACATAGACTCAAAATAAAGGG - Intergenic
973149479 4:46869238-46869260 ACTCATAGGCTCAAAATAAAGGG - Intronic
973150597 4:46882660-46882682 ACTCATAGGCTCAAAATAAAGGG - Intronic
973287620 4:48437375-48437397 ACACATAGACAGAAAATAAAGGG - Intergenic
973325776 4:48860064-48860086 ACTCACAGACAGAAGCTATGTGG + Intronic
973579578 4:52329262-52329284 ACTCACAGACTGAAAGTGAAGGG - Intergenic
973689187 4:53407863-53407885 ACACATAGACTCAAAATAAAAGG - Intronic
974083514 4:57236157-57236179 ACTCATGGACTGAAACAAGATGG - Intergenic
974182258 4:58399635-58399657 ACACATAGGCTGAAAATAAAGGG - Intergenic
974899507 4:67980215-67980237 ACACATAGACTCAAAATAAAGGG - Intergenic
975195123 4:71515829-71515851 ACATATAGACTGAAACTAAAGGG - Intronic
975227747 4:71893653-71893675 ACACATAGACTCAAAATAAAAGG + Intergenic
975261890 4:72312494-72312516 ACTGCTAGACAGAAGCCAAAAGG - Intronic
975424740 4:74213065-74213087 ACACATAGACTCAAAATAAAAGG - Intronic
975505175 4:75128943-75128965 ACACATAGGCTCAAACTAAAAGG + Intergenic
975630016 4:76390757-76390779 ACACATAGCCTGAAAATAAAGGG + Intronic
975726713 4:77299356-77299378 ACACATAGACTGAAAATAAAGGG - Intronic
976041323 4:80888262-80888284 ACAGATAGACTGAAAATAAAGGG + Intronic
976115943 4:81726478-81726500 ATGCATAGACTGAAAATAAAAGG + Intronic
976490526 4:85665383-85665405 ACACATAGGCTGAAAATAAAAGG - Intronic
976762508 4:88565590-88565612 ACACATAAACTGAAAATAAAGGG - Intronic
976819577 4:89190223-89190245 ACACATAGACTCAAAATAAAGGG - Intergenic
976941143 4:90703842-90703864 ACACATAGACTCAAAATAAAGGG - Intronic
977044689 4:92054078-92054100 ACACATAGACTGAAAATAAAGGG + Intergenic
977199314 4:94097112-94097134 ACACATAGACTGAAAGTAAAGGG - Intergenic
977399405 4:96512481-96512503 ATACATAGACTGAAAATAAAGGG + Intergenic
977854975 4:101878231-101878253 ACACATAGACTGAAAATGAAAGG + Intronic
977873399 4:102120958-102120980 GCACATAGACTGAAAATAAAAGG - Intergenic
978043245 4:104094925-104094947 ACTCATAGGCTCAAAATAAAGGG + Intergenic
978055135 4:104254196-104254218 ACACATAGACTCAAAATAAAGGG + Intergenic
978116729 4:105027826-105027848 ACAAATAGACTGAAAATAAAGGG + Intergenic
978196928 4:105982929-105982951 ACTCATAGGCTAAAAATAAAGGG - Intronic
978261910 4:106769838-106769860 ACACATAGACTGAAAACAAAGGG + Intergenic
978288419 4:107107441-107107463 ACACATAGACTCAAAATAAAGGG + Intronic
978520019 4:109605886-109605908 ACACATAGACTGAAAATAAAGGG - Intronic
978922199 4:114198250-114198272 ACACATAGACTGAAAATAAAGGG - Intergenic
979213057 4:118130051-118130073 ACACATAGACTGAAAATAAAGGG - Intronic
979262367 4:118663163-118663185 ACACAGAGACTGAAGCTTGAAGG + Intergenic
979315161 4:119253587-119253609 ACACATAGACTCAAAATAAAGGG - Intronic
979395324 4:120180772-120180794 ACACATAGACTAAAAATAAAGGG + Intergenic
979413682 4:120409409-120409431 ACACACAGACTGAAAATAAAGGG + Intergenic
979564841 4:122143143-122143165 ACACATAGACTGAAAATAAAGGG - Intergenic
979758494 4:124371817-124371839 ACTCATAGGCTCAAGCAAATAGG - Intergenic
979914874 4:126418980-126419002 ACTTATAGACTGAAGGTAAAGGG - Intergenic
979927512 4:126585666-126585688 ACTTACAGACTCAAGATAAAAGG + Intergenic
980021901 4:127720840-127720862 ACACATAGACTCAAAATAAAAGG - Exonic
980172180 4:129303352-129303374 ACACATAGACTAAAAATAAATGG - Intergenic
980366936 4:131816809-131816831 TCTCATAGACTCAAGGTAAGGGG - Intergenic
980504142 4:133692809-133692831 ACCCATAGACTCAAAATAAAGGG + Intergenic
980631457 4:135440751-135440773 ACTCATAGACTGAAAGCAAAGGG + Intergenic
980825462 4:138066776-138066798 ACATATAGACTGAAAATAAAGGG + Intergenic
981188705 4:141835877-141835899 ACACATAGACTCAAAATAAAGGG + Intergenic
981297813 4:143153371-143153393 ACACACAGACTGAAAATAAAGGG - Intergenic
981345793 4:143674664-143674686 ACACATAGACTCAAAATAAAGGG + Intronic
981460317 4:145006359-145006381 ACCCATAGTCTGAAGGTAAAGGG - Intronic
981530516 4:145749255-145749277 AAGCATAGACTGAAAATAAAGGG - Intronic
981591149 4:146363140-146363162 ACACATAGACTGAAAATGAAGGG + Intronic
981647217 4:147013084-147013106 ACCCAGAGACTAAAGGTAAAAGG + Intergenic
981895884 4:149798621-149798643 ACACATAGACTGAAAATAAAGGG + Intergenic
981899951 4:149850343-149850365 ACACATAGACTCAAAATAAAAGG + Intergenic
982045166 4:151437715-151437737 ACCCATAGAGTGAATCTTAATGG + Intronic
982246546 4:153357924-153357946 ACTCATAGTCTGTTGCTATATGG - Intronic
982398810 4:154943178-154943200 AGTCATAAACTGAGGCTAAAGGG + Intergenic
982511470 4:156288457-156288479 ACACATAGGCTGAAAATAAAAGG - Intergenic
982683111 4:158456607-158456629 ATACATAGACTGAAAATAAAGGG - Intronic
982829944 4:160046447-160046469 TCTCATAAACTTAAGGTAAAGGG + Intergenic
982932967 4:161431741-161431763 ACACATAGACTGAAAATAAAGGG + Intronic
982984745 4:162193018-162193040 ACTCATAGAATGAGAGTAAATGG + Intergenic
983022616 4:162697914-162697936 ACATATAGACTGAAAGTAAAAGG - Intergenic
983047248 4:163002587-163002609 ACACATAGGCTGAAAATAAAGGG - Intergenic
983050498 4:163040525-163040547 ATTCACAGACTGAAAATAAAGGG + Intergenic
983102879 4:163647036-163647058 ACACATAGACTGAAAGTGAAGGG + Intronic
983149469 4:164260166-164260188 ACACACAGACTGAAGCTTGAAGG - Intronic
983165724 4:164475098-164475120 ACACATAGACTGAAAGTAACGGG - Intergenic
983173034 4:164557365-164557387 ACACATAGGCTGAAAATAAAAGG - Intergenic
983324864 4:166240978-166241000 ACACAAAAACTGCAGCTAAAGGG - Intergenic
983389158 4:167105767-167105789 ACATATAGATTGAAGATAAAGGG + Intronic
983424301 4:167562872-167562894 ACACATAGACTCAAAATAAAGGG - Intergenic
983579831 4:169297309-169297331 ACTCAAAGACTGAAAATAAAGGG + Intergenic
983658147 4:170103591-170103613 ACGCATTGACTGAAAATAAAGGG + Intergenic
983665581 4:170177965-170177987 ACACATAGGCTGAAACTAAAGGG - Intergenic
983683763 4:170383328-170383350 ACACATAGGCTGAAAATAAAGGG - Intergenic
983749703 4:171251191-171251213 ACACATAAACTTAAGGTAAAGGG - Intergenic
984310323 4:178050158-178050180 ACACATAGACTGTAAATAAAGGG - Intergenic
984529441 4:180898794-180898816 ACACATAGACTGAAAATAAAGGG - Intergenic
985229788 4:187802307-187802329 ACACATAGACTGAAAATAGATGG + Intergenic
985690390 5:1306934-1306956 ACACATAGACTGAAAATAAAAGG - Intergenic
986366132 5:7033768-7033790 ACACATAGACTGAAAGTGAATGG + Intergenic
986620590 5:9669036-9669058 ACTCATAGGCTCAAAATAAAGGG + Intronic
986630926 5:9772860-9772882 ACACATAGACTGAAAATAAAGGG - Intergenic
986756584 5:10842429-10842451 ACAAATAGACTGAAAATAAAGGG + Intergenic
986885011 5:12223475-12223497 ACACATAGACTAAAAATAAAGGG - Intergenic
987272048 5:16320360-16320382 TCTCATAGACTGCTGCTAAAAGG - Intergenic
987605940 5:20136457-20136479 ACACATAGACTCAAAATAAAGGG - Intronic
987631728 5:20481114-20481136 ACACATAGACTGAAAATAAAGGG + Intronic
987911884 5:24157547-24157569 ACACATAGACTGTAAATAAAAGG + Intronic
987952933 5:24699603-24699625 ACACGTAGACTGAAAATAAAGGG - Intergenic
988076331 5:26360434-26360456 ACACATAGGCTCAAGATAAAGGG - Intergenic
988083043 5:26437023-26437045 ACACATAGACTGAAAATAAATGG + Intergenic
988203972 5:28110453-28110475 ACACATAGACTCAAAATAAAGGG - Intergenic
988208112 5:28166635-28166657 AGTCAAAGAATGAAGCTAAGAGG + Intergenic
988334000 5:29881470-29881492 ACACATAGACTAAAACTATAGGG + Intergenic
988348820 5:30073945-30073967 ACTCATAGCCTAAAAATAAAGGG + Intergenic
988608063 5:32698834-32698856 ACACATAGACTGAAAATAAAGGG - Intronic
988931822 5:36042660-36042682 ACACATAGACTGAAAATAAAGGG + Intronic
989046012 5:37274339-37274361 ATTCATATACTGAAGAGAAAGGG - Intergenic
989074578 5:37550603-37550625 ACACACAGACTGAAAATAAAGGG - Intronic
989215221 5:38898461-38898483 ACATATAGACTGAAGATAAAGGG - Intronic
989323940 5:40167807-40167829 ACCCATAGGCTGAAGGTAAAGGG + Intergenic
989378241 5:40787969-40787991 ACTCATAGACTGAAAATGAAGGG + Intronic
989428063 5:41318873-41318895 ACACATAGACCGAAAATAAAGGG + Intronic
989629560 5:43467363-43467385 ACACATAGACTGAAAGTGAAGGG + Intronic
990121212 5:52454654-52454676 ACTAATAGACTAATGTTAAATGG - Intergenic
990230098 5:53704054-53704076 ACACATAGACTCAAAATAAAAGG - Intergenic
990360547 5:55014471-55014493 ACACATAGACTCAAAATAAAGGG + Intronic
990541749 5:56780196-56780218 ACACATAGACTCAAAATAAAGGG - Intergenic
990853996 5:60242110-60242132 ACACACAGACTGAAACTAAAAGG + Intronic
990913637 5:60879734-60879756 ACACATAGGCTGAAAATAAAGGG - Intronic
991089071 5:62676671-62676693 ACACATAGACTCAAAATAAAGGG - Intergenic
991161068 5:63503767-63503789 ACTCATAGGCTCAAAGTAAAGGG - Intergenic
991180353 5:63744259-63744281 ACACATAGACTGAAAATAAAGGG - Intergenic
991205477 5:64044947-64044969 ACACATAGACTGAAAATAAAAGG + Intergenic
991276011 5:64847166-64847188 ACACATAGATGGAAGCTGAAGGG + Intronic
991571762 5:68061939-68061961 ACACATAGACTCAAAATAAAGGG + Intergenic
991672370 5:69061433-69061455 ACACATAGACTGAAAATAAAGGG - Intergenic
992012847 5:72547221-72547243 ACACATAAACTGAAAATAAAGGG - Intergenic
992276106 5:75120887-75120909 ACACATAGACAAAAGATAAAGGG + Intronic
992372475 5:76158324-76158346 ACAAATAGACTGAAAGTAAAAGG + Intronic
992531544 5:77656873-77656895 ACACATAGACTGAAAATAAAGGG - Intergenic
992545290 5:77808695-77808717 ACACATAGACTGAGAGTAAAGGG - Intronic
992934750 5:81690376-81690398 ACACAAAGACTGAAAATAAAGGG + Intronic
993267356 5:85743386-85743408 ACACATAGACTGAAAATAAAGGG - Intergenic
993268998 5:85768958-85768980 ACACATAGACTGAAATTAAAGGG - Intergenic
993431569 5:87839093-87839115 ACATATAGACTGAAACTGAAGGG - Intergenic
993779529 5:92049327-92049349 ACTCAAAGACTCAATGTAAAGGG - Intergenic
993948587 5:94145472-94145494 ATACATAGACTGAAAATAAAGGG + Intergenic
994142624 5:96359203-96359225 ACACATAGGCTCAAGATAAAGGG - Intergenic
994226465 5:97256912-97256934 ACACATACACTGAAAATAAAGGG + Intergenic
994233307 5:97334269-97334291 ACACATAGGCTCAAGATAAAGGG - Intergenic
994236816 5:97372177-97372199 ACTCATAGGCTCAAAGTAAAGGG + Intergenic
994299017 5:98123663-98123685 ACACATAGACTCAAAATAAAAGG + Intergenic
994309836 5:98256693-98256715 ACACACAGACTGAAAATAAAGGG - Intergenic
994633653 5:102317831-102317853 ACACATAGACTGAAAATAAAAGG - Intergenic
994654164 5:102568917-102568939 ACACATAGACTGAAAATGAAGGG - Intergenic
994726726 5:103444784-103444806 ACTCAGAGTCTGAAGCAAAGTGG - Intergenic
994821372 5:104654930-104654952 CCTTATAGACTCAATCTAAAAGG + Intergenic
994854045 5:105093657-105093679 ACTCAAAGACTAAAAATAAAAGG + Intergenic
994917393 5:105998359-105998381 ACCCATAGACTGAAAGTGAAGGG - Intergenic
995049884 5:107690566-107690588 ACACATAGACTGAAAATAAAAGG + Intergenic
995265577 5:110155410-110155432 ACACATAGACTGAAAATAAAGGG + Intergenic
995572909 5:113500317-113500339 ACCCATAGACTGAGAATAAATGG - Intergenic
995777734 5:115743382-115743404 ACACATAGACTGAATATAAAAGG - Intergenic
995811510 5:116112332-116112354 ACACATAGACTAAAAGTAAAGGG - Intronic
995919360 5:117292878-117292900 ACTTATAAGTTGAAGCTAAATGG - Intergenic
995998990 5:118334820-118334842 ACTTATAGACTGAAAGTAATGGG + Intergenic
996162517 5:120182596-120182618 ACACAAAGACTGAAAATAAAGGG + Intergenic
996192427 5:120562344-120562366 ACACATGGACTGAAAATAAAGGG - Intronic
996608817 5:125355659-125355681 TCACATAGACTTAAGGTAAAGGG - Intergenic
996659631 5:125986284-125986306 ACACACAGACTGAAAATAAAGGG - Intergenic
996835203 5:127783999-127784021 TCTCATAAACTTAAGGTAAAGGG - Intergenic
996879373 5:128277486-128277508 ACTCTTTGACTGAAGGAAAAGGG - Intronic
996927782 5:128848685-128848707 ACTAATAGACTGAAAATAAAGGG + Intronic
997010167 5:129867384-129867406 ACTCATAGGCTCAAAATAAAGGG + Intergenic
997771014 5:136553785-136553807 ACACATAGGCTGAAAGTAAATGG - Intergenic
997802319 5:136876954-136876976 ACATATAGACTGAAAGTAAAGGG + Intergenic
997832919 5:137167093-137167115 ACACATAGACTGAAAATAAAGGG + Intronic
999002232 5:147936909-147936931 ACACACAGACTGAAAATAAAGGG - Intergenic
999027239 5:148248211-148248233 ACACATAGACAGAAAATAAAGGG - Intergenic
999029825 5:148279149-148279171 ACACATAGACTCAAAATAAAGGG - Intronic
999345914 5:150819525-150819547 ACACATAGGCTGAAAATAAAGGG + Intergenic
999488443 5:152024558-152024580 ACACATAGACTCAAAATAAAGGG - Intergenic
1000874149 5:166615224-166615246 ACTCATGGACAGGAGATAAAGGG - Intergenic
1001240486 5:170065898-170065920 ACTCATAGACTGAAAGTGAAGGG + Intronic
1001355668 5:171020643-171020665 ACACATAGGCTCAAGATAAAGGG - Intronic
1003139652 6:3459350-3459372 CCTCTAAAACTGAAGCTAAAAGG + Intergenic
1003438518 6:6118082-6118104 ACACATAGACTCAAAATAAATGG - Intergenic
1003457665 6:6298617-6298639 ACACATAGGCTCAAGATAAAAGG - Intronic
1003686861 6:8313172-8313194 ACACATAGACTCAAAATAAAGGG - Intergenic
1003764078 6:9215735-9215757 GCTCATAGGCTCAAACTAAAAGG + Intergenic
1004056277 6:12141637-12141659 ACACATAGACTCAAAATAAAGGG + Intronic
1005356902 6:24993450-24993472 ACTCATAGGCTTAAAATAAAAGG - Intronic
1005793703 6:29334053-29334075 ACTGATAGACTCAAGGTAAAGGG + Intergenic
1005927866 6:30459385-30459407 ACACATAGACTGAAAATAAAGGG + Intergenic
1006062781 6:31437586-31437608 TCACATAAACTGAAGGTAAAGGG - Intergenic
1006318863 6:33307345-33307367 AGGCATAGGCTGAAGCTATATGG + Intronic
1007022346 6:38533189-38533211 ACACATAGACTGAAAATAAAGGG + Intronic
1007080017 6:39093575-39093597 TGTCAAAGACTGGAGCTAAAGGG - Intergenic
1007092396 6:39192321-39192343 ACTCTTTGAAGGAAGCTAAAGGG + Intronic
1008108685 6:47468306-47468328 ACACATAGACTGAAAATAAAGGG + Intergenic
1008248869 6:49212417-49212439 ACTCATAGGCTCAAAGTAAAGGG + Intergenic
1008314889 6:50027417-50027439 ACACATAGACTAAAAATAAATGG + Intergenic
1008351944 6:50501709-50501731 ACATATAGACTGAAAGTAAAGGG + Intergenic
1008402840 6:51084031-51084053 ACACATAGACTTAAAATAAAGGG - Intergenic
1008707357 6:54179265-54179287 ACTCACAGAGTGAAAATAAAGGG - Intronic
1008727308 6:54438444-54438466 ACACATAGACTAAAAATAAAGGG - Intergenic
1008751836 6:54744106-54744128 ACACACAGACTGAAAGTAAAGGG - Intergenic
1008858267 6:56117224-56117246 ACACATAGACTAAAAATAAAGGG + Intronic
1008992820 6:57623299-57623321 TCTTATAGGCTGAAGATAAATGG + Intronic
1009181441 6:60522417-60522439 TCTTATAGGCTGAAGATAAATGG + Intergenic
1009186572 6:60581099-60581121 ACACATAGGCTCAAGATAAAGGG + Intergenic
1009282223 6:61767322-61767344 ACACACAGACTGAAAATAAAGGG - Intronic
1009329505 6:62399014-62399036 ACTCATAAACTGAAAATAAAGGG - Intergenic
1009371427 6:62908091-62908113 ACACATAGACAAAAGATAAAGGG + Intergenic
1009495622 6:64342828-64342850 ACACATAGACTCAAAATAAAGGG + Intronic
1009709391 6:67298535-67298557 ACACATAGACTCAAAATAAAGGG - Intergenic
1009748348 6:67849300-67849322 ACACATAGACTGAAGATAAATGG + Intergenic
1009805468 6:68596646-68596668 GCCCATAGACTCAAACTAAAGGG - Intergenic
1009823866 6:68840879-68840901 ACACATAGACTGAAAATAAAGGG + Intronic
1009847116 6:69147997-69148019 ACAAATAGACTGAAAGTAAAGGG - Intronic
1009875672 6:69501681-69501703 ACACATAGACTGAAAGTGAAGGG + Intergenic
1009924975 6:70109671-70109693 ACTCAAAGACTAAAGATAATGGG - Intronic
1009978234 6:70697091-70697113 ACACAAAGACTGAAAATAAAGGG - Intronic
1010054809 6:71552506-71552528 ACACATAGACTGAAAGTGAAGGG - Intergenic
1010061910 6:71633073-71633095 ACACACAGACTGAAACTAAAGGG - Intergenic
1010077156 6:71812271-71812293 ACACATAGGCTGAAAATAAAGGG + Intergenic
1010276737 6:73976896-73976918 ACACATAGGCTCAAACTAAAGGG - Intergenic
1010279791 6:74011043-74011065 ACTCATAGGCTCAAAATAAAGGG - Intergenic
1010319119 6:74486140-74486162 ACACATAGACTCAAAATAAAAGG + Intergenic
1010456885 6:76066338-76066360 ACTCATAGACTGAAGCTAAAGGG + Intronic
1010483337 6:76380112-76380134 ACACAAAGACTGAAAATAAAGGG - Intergenic
1010500920 6:76599242-76599264 ACACATAGACTCAAAATAAAGGG + Intergenic
1010514468 6:76756207-76756229 ACCCATAGACTGAAAACAAAAGG + Intergenic
1010546259 6:77160209-77160231 ACACATAGACTGAAAATAAAGGG - Intergenic
1010626502 6:78142248-78142270 ACAAATAGACTGAAAATAAAGGG + Intergenic
1010626814 6:78146775-78146797 ACACATAGTCTGAAAGTAAAGGG + Intergenic
1010638716 6:78294347-78294369 ACACATAGACTGAAAGGAAAGGG + Intergenic
1010725007 6:79323521-79323543 ACACATAGACTCAAAATAAAGGG - Intergenic
1010727241 6:79349032-79349054 ACACATAGGCTCAAGATAAAGGG + Intergenic
1010728848 6:79366765-79366787 ACACATAGACTCAAAATAAAGGG - Intergenic
1010839046 6:80625642-80625664 ACACATAGACTGAAAATAAAAGG + Intergenic
1010839875 6:80636285-80636307 ACTCATAGACTCAAAGTAAAGGG + Intergenic
1011020456 6:82807353-82807375 ACTCATAGGCTCAAAATAAAGGG - Intergenic
1011138916 6:84131712-84131734 ACACATAGGCTCAAGATAAAGGG - Intronic
1011159108 6:84368405-84368427 ACACATAGACTCAAAATAAAAGG - Intergenic
1011225880 6:85106371-85106393 ACACATAGACTGAAAATAAAGGG - Intergenic
1011234829 6:85204268-85204290 ACACATAGGCTCAAACTAAAGGG + Intergenic
1011244291 6:85306095-85306117 ACACATAGACTCAAAATAAAGGG - Intergenic
1011359504 6:86508282-86508304 ACATATAGACTGAAAATAAAGGG - Intergenic
1011373273 6:86663590-86663612 ACACATAAACTTAAGGTAAAGGG - Intergenic
1011386052 6:86799304-86799326 ACAAATAGACTGAAAATAAATGG - Intergenic
1011520727 6:88202020-88202042 ACACATAGACTGAAAATAAAGGG + Intergenic
1011587110 6:88938395-88938417 ACACATAGACTGAAAGTAAAGGG - Intronic
1011696177 6:89915410-89915432 ACACATAGACTGAAAGTAGAGGG - Intergenic
1011716671 6:90112876-90112898 ACTCATAGGCTCAAAATAAAAGG + Intronic
1011838726 6:91468831-91468853 ACACATAGACTCAAAATAAAGGG - Intergenic
1011901644 6:92305196-92305218 ACACTTAGACTGAAAATAAAGGG + Intergenic
1012050153 6:94331205-94331227 ACACATAGACTAAAAATAAAGGG + Intergenic
1012238513 6:96845668-96845690 ACCCATAGACTCAAAGTAAAGGG + Intergenic
1012434602 6:99202236-99202258 ACACATAGACTCAAAATAAAGGG - Intergenic
1012459931 6:99449292-99449314 ACACATAGACTCAAAATAAAAGG + Intronic
1012656389 6:101827549-101827571 ACCCATAGACTCAAAATAAAAGG + Intronic
1012712539 6:102626397-102626419 ACAAATAGACTGAAAATAAAGGG - Intergenic
1012714870 6:102655799-102655821 ACATATAGACTGAAAATAAAGGG + Intergenic
1012717564 6:102696326-102696348 ATACATAGACTGAAAATAAAGGG - Intergenic
1012871111 6:104673343-104673365 ACTCATAGAATCAAAATAAAGGG + Intergenic
1012940742 6:105412305-105412327 ACACATAGATTGAAAATAAAAGG + Intergenic
1013902750 6:115177362-115177384 ACACATAGACTCAAAATAAAAGG + Intergenic
1013925337 6:115465368-115465390 ACACATAGACTGAAAATAAAAGG - Intergenic
1014022603 6:116608306-116608328 ACTCACAGGCTCAAGGTAAAGGG + Intergenic
1014039956 6:116814854-116814876 ACATATAGACTGAAAGTAAAGGG + Intronic
1014118683 6:117697431-117697453 ACACACAGACTGAAAATAAAGGG + Intronic
1014378689 6:120711514-120711536 ACACATAAACTGAAAATAAAGGG + Intergenic
1014423147 6:121269384-121269406 ACACATAGGCTGAAAATAAAGGG + Intronic
1014424487 6:121287275-121287297 ACACATAGGCTGAAAATAAAAGG + Intronic
1014584825 6:123184733-123184755 ACACATAGACTCAAAATAAAGGG + Intergenic
1015348058 6:132182518-132182540 TCACATAAACTTAAGCTAAAGGG + Intergenic
1015679079 6:135783463-135783485 ACCCATAGACTCAAAATAAAGGG + Intergenic
1015907585 6:138133058-138133080 ACACATAGACTAAAAATAAAGGG - Intergenic
1016018113 6:139206772-139206794 TCACATAGACTTAAGGTAAAGGG + Intergenic
1016075105 6:139786742-139786764 ACCCATAGGCTGAAAGTAAAGGG - Intergenic
1016245174 6:141971792-141971814 ACACATAGTCTGAAAATAAAAGG + Intergenic
1016251802 6:142051713-142051735 ACAGATAGACTGAAAATAAAGGG + Intergenic
1016483272 6:144506129-144506151 ACACATAGACTCAAAATAAAGGG - Intronic
1016524322 6:144984110-144984132 ACACATAGACTGAAAGTGAAGGG - Intergenic
1016538135 6:145132439-145132461 ACACATAGACTGAAAATAAAAGG - Intergenic
1016567795 6:145476046-145476068 ACACATAGACTGAAAATAAAGGG + Intergenic
1017243064 6:152192929-152192951 ACACATACACTGAAAATAAAGGG - Intronic
1017318894 6:153065076-153065098 ACACATAGACTTAAAATAAAGGG + Intronic
1017579271 6:155844260-155844282 ACACATAGACTGAAAATAAAGGG + Intergenic
1017601500 6:156087744-156087766 ACTCATAGGCTCAACATAAAGGG + Intergenic
1017684243 6:156896109-156896131 ACTCTAAGACAGAAGGTAAATGG - Intronic
1017803240 6:157918465-157918487 ACACATATACTGAAAGTAAACGG - Intronic
1017933931 6:158987328-158987350 ACACATAGACTGAAAGTAAAGGG - Intronic
1017974223 6:159340671-159340693 ACATATAGACTGAAAATAAAGGG + Intergenic
1018052044 6:160018136-160018158 AGACATACACTGAAGCTAAAGGG + Intronic
1018296942 6:162358030-162358052 ACACAAAGAATGAAGCTTAATGG + Intronic
1019805836 7:3123798-3123820 ACACATAGACTCAAAATAAAAGG + Intergenic
1020343972 7:7143466-7143488 ACACATAGGCTGAAAATAAAGGG - Intergenic
1020422773 7:8027747-8027769 AAACATAGACTTAAACTAAAAGG + Intronic
1020781470 7:12521081-12521103 ACACATAGACTGAAAATGAAGGG - Intergenic
1020912423 7:14148670-14148692 ACTGATACACTGATTCTAAAAGG + Exonic
1021177505 7:17467036-17467058 AGGGATAGACTGAAGTTAAATGG + Intergenic
1021353964 7:19630760-19630782 ACACATAGACTAAAAATAAAGGG + Intergenic
1021516289 7:21490894-21490916 ACTTTTAGTCTGAACCTAAACGG + Intronic
1021587120 7:22221331-22221353 CCTCACAGATTGAAGTTAAATGG - Intronic
1021768726 7:23976828-23976850 ACACACAGACTGAAGGTGAAGGG - Intergenic
1021842967 7:24736300-24736322 ACATATAGACTGAAAATAAAGGG + Intronic
1021861662 7:24911905-24911927 ACTGGTAGACTAGAGCTAAAAGG + Intronic
1021933422 7:25605157-25605179 ACACATAGGCTGAAAATAAAAGG + Intergenic
1022080558 7:27015987-27016009 ACACATAGACTGAAAATAAAGGG + Intergenic
1022346647 7:29522266-29522288 ACACATAGACTGAAAGTGAAGGG + Intergenic
1022348493 7:29542000-29542022 ACATATAGACTGAAAATAAAGGG + Intergenic
1022630973 7:32084124-32084146 ACACATAGGCTCAAGATAAAAGG + Intronic
1022727686 7:32996005-32996027 ACTCCAAGACTGACGCTGAAAGG - Intronic
1022875689 7:34526575-34526597 ACACATAGACTGAAAATAAAGGG - Intergenic
1022960283 7:35419475-35419497 ACTCACTTACTGAAGCTAAAAGG + Intergenic
1023208725 7:37779864-37779886 GCACATAGACTGAAAATAAAAGG - Intronic
1023511388 7:40957506-40957528 ACACATAGGCTGAAAATAAAGGG - Intergenic
1023716446 7:43048783-43048805 ACACATAGACTGAAAATAAAGGG + Intergenic
1024008065 7:45241827-45241849 ACTCAGAGACTGAAGGGAGACGG - Intergenic
1024368827 7:48556670-48556692 ACACATAGACTGAAAATAAAGGG - Intronic
1024498559 7:50074544-50074566 ACACATAGGCTGAAAATAAAGGG + Intronic
1024661003 7:51494832-51494854 ACACATAGACTGAAAATAAAAGG - Intergenic
1024956756 7:54929280-54929302 ACACATAGACTGAAAATAAAAGG + Intergenic
1025045897 7:55691636-55691658 ACTCCAAGACTGACGCTGAAAGG + Intergenic
1025154028 7:56586929-56586951 ACACATAGGCTGAAAATAAAAGG + Intergenic
1025552626 7:62269600-62269622 ACACATAGACTCAAAATAAAGGG - Intergenic
1025594956 7:62912742-62912764 ACACATAGACTCAAAATAAAGGG - Intergenic
1025609210 7:63062360-63062382 ACACATAGGCTCAAGATAAAAGG + Intergenic
1025617322 7:63132341-63132363 ACAAATAGACTGAAAATAAAGGG + Intergenic
1027279454 7:76595542-76595564 ACCCATAGACTCAAAGTAAAGGG + Intergenic
1027349825 7:77300016-77300038 ACACATAGACTGAAAGTGAAGGG - Intronic
1027445835 7:78272809-78272831 ACACATAGACTCAAAATAAAGGG - Intronic
1027447419 7:78290225-78290247 ACACATAGACTCAAATTAAAGGG + Intronic
1027507966 7:79042395-79042417 ACTCATAGGCTCAAAGTAAAGGG - Intronic
1027808509 7:82861231-82861253 ACACATAGACTGAAAATAAAGGG + Intronic
1027826380 7:83121649-83121671 ACACATAGACTGAAAATAAATGG + Intronic
1027910512 7:84244457-84244479 ACACATAGACTCAAAATAAAGGG - Intronic
1027996348 7:85429819-85429841 ACACAGAGACTGAAAATAAAGGG + Intergenic
1028002328 7:85514927-85514949 AGACATAGACAGAAGTTAAATGG + Intergenic
1028033369 7:85947789-85947811 ACACACAGACTGAAAATAAAGGG - Intergenic
1028161250 7:87487441-87487463 ACACATAGACTGAAAATTAAGGG + Intergenic
1028206947 7:88028869-88028891 ACACATAGACTGAAAATAAAAGG - Intronic
1028284427 7:88978571-88978593 ACACATAGACTGAAAATAAAGGG - Intronic
1028339274 7:89697760-89697782 ACACACAGACTGAAAATAAAGGG + Intergenic
1028442742 7:90882209-90882231 ACACATAGACTCAAAATAAAGGG + Intronic
1028626000 7:92877817-92877839 ACACATACACTGAAAGTAAAGGG + Intergenic
1028626818 7:92887214-92887236 ACACATAGACTCAAAATAAAAGG - Intergenic
1028780563 7:94730745-94730767 ACACATAGACTGAAAACAAAGGG + Intergenic
1028865603 7:95707884-95707906 ACTCATAGATTCAAAATAAAGGG + Intergenic
1028950325 7:96628128-96628150 ACACATAGACTGAAAATAAAGGG - Intronic
1029867137 7:103645405-103645427 ACTTACAGACTAAAGATAAAGGG + Intronic
1030200675 7:106900426-106900448 ACTCATAGGCTCAAAATAAAGGG - Intronic
1030408061 7:109140150-109140172 ACACATAGAATGAAAATAAAGGG - Intergenic
1030431330 7:109452656-109452678 ACACATAGACTGAAAATGAAGGG - Intergenic
1030449494 7:109691000-109691022 ACACATAGACTCAAAATAAAGGG - Intergenic
1030705408 7:112688040-112688062 ACACATAGACTCAAAATAAAGGG - Intergenic
1030734205 7:113025530-113025552 ACACATAGACTGAAAATAACAGG - Intergenic
1031652255 7:124304916-124304938 ACACATAGACTCAAAATAAAGGG - Intergenic
1031676995 7:124622799-124622821 ACACAAAGACTGAAGGTGAAGGG + Intergenic
1031803484 7:126278046-126278068 ACACATAGACTCAAAATAAAGGG - Intergenic
1032029089 7:128467559-128467581 ACTCAGTCACTGAAGCTAGAAGG + Intergenic
1032317996 7:130858219-130858241 ACACATAGACTGAAAGTGAAGGG + Intergenic
1032901814 7:136318678-136318700 ACATATAGACTGAAAGTAAAGGG - Intergenic
1032939419 7:136771513-136771535 ACATATAGACTAAAGATAAAGGG + Intergenic
1032941006 7:136791460-136791482 ACATATAGACTGAAAATAAAGGG + Intergenic
1032968732 7:137133392-137133414 ACTCATAGGCTCAAAATAAAGGG + Intergenic
1033691506 7:143741792-143741814 ACACATAGACTGAAAATAAGGGG + Intergenic
1033780513 7:144663722-144663744 ACACATAGACTCAAAATAAAGGG + Intronic
1033833482 7:145281650-145281672 ACACATAGACTGAAAATAAAGGG - Intergenic
1034364140 7:150531756-150531778 ACTCATAGGCTCAAAATAAAGGG - Intergenic
1034373076 7:150617512-150617534 ACACATAGACTCAAAATAAAGGG - Intergenic
1034644235 7:152630734-152630756 ACACATAGACTCAAAATAAAGGG - Intergenic
1035427620 7:158791135-158791157 ACTCATAGACAGAAGCGGAATGG - Intronic
1035653921 8:1291295-1291317 TCTCATGGACTCAAGATAAAGGG + Intergenic
1036036205 8:5022142-5022164 ACTCAAAGAGTGAATCAAAATGG + Intergenic
1036061742 8:5329618-5329640 ACACGTAGACTGAAAATAAAGGG - Intergenic
1036913615 8:12783130-12783152 ACACACAGACTGAAAGTAAAGGG - Intergenic
1037144806 8:15559872-15559894 ACACATAGACTCAAAATAAAAGG - Intronic
1037146572 8:15580186-15580208 ACACATAGACTCAAAATAAAAGG - Intronic
1037380094 8:18275849-18275871 CCTCATTGACTGAATCTAACTGG - Intergenic
1037664767 8:20958481-20958503 ACACATAGACTCAAAATAAAGGG + Intergenic
1037697846 8:21242851-21242873 ACACATAGACTGAAAGTAAAGGG - Intergenic
1038225370 8:25652086-25652108 ACACATAGACTGAAAGAAAAAGG - Intergenic
1038870398 8:31487680-31487702 ACACATAGACTCAAAATAAAGGG - Intergenic
1038998189 8:32949330-32949352 ACACATAGGCTGAAGATGAAAGG - Intergenic
1039009948 8:33082631-33082653 ACAAATAGACTGGAACTAAAGGG - Intergenic
1039265439 8:35818267-35818289 ACACATAGACTCAAAATAAAGGG + Intergenic
1039281300 8:35988172-35988194 ACACATAGACTCAAAATAAAGGG - Intergenic
1039420918 8:37439215-37439237 ACACACAGACTGAAAATAAAGGG - Intergenic
1039672526 8:39618072-39618094 ACACATAGACTGAAAGTAAATGG + Intronic
1039707231 8:40020264-40020286 ACACATAGGCTGAAAATAAAGGG - Intergenic
1039763681 8:40606038-40606060 TCACATAAACTGAAGGTAAAGGG - Intronic
1039767838 8:40649197-40649219 ACACATAGACTCAAAATAAAGGG + Intronic
1039802011 8:40966103-40966125 ACACATAGGCTGAAAATAAAGGG + Intergenic
1040720845 8:50321397-50321419 ACACATAGACTGATAATAAAGGG - Intronic
1041021171 8:53640573-53640595 ACACATAGACTCAAAATAAAGGG - Intergenic
1041296174 8:56359364-56359386 ACATATAGACTGAAAGTAAAGGG - Intergenic
1041302901 8:56431354-56431376 ACACATAGACTCAAAATAAAGGG + Intergenic
1041387997 8:57324795-57324817 ACACATAGACTCAAAATAAAGGG - Intergenic
1041557290 8:59172528-59172550 ACACATAGGCTCAAGATAAAAGG - Intergenic
1041579679 8:59444420-59444442 AAACATAGACTGAAAATAAAGGG - Intergenic
1041655096 8:60341225-60341247 ACCCATAGACTCAAAATAAAGGG + Intergenic
1041665701 8:60442823-60442845 ACACATAGGCTCAAACTAAAGGG - Intergenic
1041666526 8:60450336-60450358 ACTCATAGGCTCAAAATAAATGG + Intergenic
1041887840 8:62832524-62832546 ACTCATAGGCTCAAAGTAAAAGG + Intronic
1041906933 8:63043614-63043636 ACACATAGACTGAAAGTGAAGGG - Intergenic
1042630517 8:70810562-70810584 ACACATAGACTCAAAATAAAGGG + Intergenic
1042637254 8:70892119-70892141 ACATATAGACTGAAAGTAAAGGG - Intergenic
1042726586 8:71885498-71885520 ACTCATAGACTGAAAATAAAGGG - Intronic
1042897037 8:73681751-73681773 TCACATAAACTGAAGGTAAAGGG + Intronic
1042970027 8:74398334-74398356 ACACATAGACTCAAAATAAAAGG - Intronic
1042970213 8:74400421-74400443 ACACATAGACTCAAAATAAAAGG - Intronic
1042980627 8:74522932-74522954 ACACGTAGACTGAAAATAAAGGG + Intergenic
1042987192 8:74598099-74598121 ACACATAGACTCAAAATAAAAGG - Intergenic
1043009942 8:74868658-74868680 ACACATAGACTCAAAATAAAAGG + Intergenic
1043145056 8:76642652-76642674 ACACATAAACTGAAAATAAAGGG + Intergenic
1043340551 8:79232434-79232456 ACATATAGGCTGAAGGTAAAGGG + Intergenic
1043368039 8:79558527-79558549 ACACATAGGCTGAAAATAAAGGG - Intergenic
1043640980 8:82450349-82450371 ACTCATAGGCTCAAAGTAAAGGG - Intergenic
1043732567 8:83701896-83701918 ACTGCTTGGCTGAAGCTAAAAGG + Intergenic
1043843807 8:85141087-85141109 ACTCCTAGACTCAAAATAAATGG + Intronic
1044007723 8:86958697-86958719 ACACATAGGCTGAAAATAAAGGG - Intronic
1044126130 8:88459639-88459661 ACTCATAGGCTCAAAATAAAGGG + Intergenic
1044135675 8:88582924-88582946 ACACATAGACTCAAAATAAAGGG - Intergenic
1044241736 8:89895933-89895955 ATACATAGACTGAAAATAAAAGG + Intergenic
1044272779 8:90266367-90266389 ACACATAGACTCAAAATAAAGGG + Intergenic
1044350708 8:91162618-91162640 ACACATAGACTGAAAGTTAAGGG - Intronic
1044615408 8:94135525-94135547 ACACATAGACTCAAAATAAAAGG - Intronic
1044635173 8:94316636-94316658 ACACATAGCCTGAAAGTAAAGGG - Intergenic
1044876868 8:96677549-96677571 ACTAATATACAGAATCTAAAAGG - Intronic
1045095045 8:98788552-98788574 TCACATAAACTTAAGCTAAAGGG + Intronic
1045164757 8:99591217-99591239 ACACATAGACTCAAAATAAAGGG - Intronic
1045241307 8:100404069-100404091 ACACATAGACTCAAAATAAAAGG + Intronic
1045590199 8:103585006-103585028 ACACACAGACTGAAAATAAAGGG + Intronic
1045607326 8:103791693-103791715 ACACATAGACTCAAAATAAAGGG + Intronic
1045699256 8:104847926-104847948 ACCCATAGACTTAAAATAAAGGG - Intronic
1045727620 8:105193953-105193975 ACACATAGACTGAAAATAAAGGG - Intronic
1045800923 8:106099722-106099744 ACACATAGACTAAAAATAAAGGG + Intergenic
1045945571 8:107791339-107791361 ACACAGAGACTGAAGGTAAAAGG + Intergenic
1046119294 8:109825313-109825335 ACACATAGATTGAAAATAAAGGG - Intergenic
1046483399 8:114853097-114853119 ACACATAGACTGAAAATAAAGGG - Intergenic
1046483575 8:114855532-114855554 ACACATAGACTGAAAATAAAGGG - Intergenic
1046972296 8:120236487-120236509 ACACATAGACTCAAAATAAAGGG - Intronic
1047102252 8:121690114-121690136 ACTTTTAGACTGAAAGTAAAGGG + Intergenic
1047121535 8:121910184-121910206 TCACATAGACTGAAAATAAAGGG + Intergenic
1047357019 8:124131626-124131648 ACCCATAGGCTCAAGGTAAAGGG + Intergenic
1047841421 8:128757636-128757658 ACACATAGACTGAAAATAAAGGG + Intergenic
1047933869 8:129756130-129756152 ACACATAGACTGAAAATAAAGGG + Intronic
1048322725 8:133413106-133413128 ACACATAGGCTGAAAGTAAAAGG - Intergenic
1049485055 8:142852209-142852231 ACACATAGGCTGAAAATAAATGG + Intronic
1050040252 9:1484154-1484176 ACTTATACACTGAAAATAAAGGG - Intergenic
1050121373 9:2312003-2312025 ATACATAGACTGAAAATAAAGGG - Intergenic
1050379935 9:5017961-5017983 ACACATAGACTGAAAGTAAAGGG - Intronic
1050676491 9:8061460-8061482 ACATATAGACTGAACATAAAGGG - Intergenic
1050841613 9:10156998-10157020 ACTCATAGTCTCAAAATAAAAGG - Intronic
1050956221 9:11664707-11664729 ACACATAGGCTGAAAGTAAAGGG - Intergenic
1050972818 9:11898133-11898155 AAACATAGAATGAAGCTAAATGG - Intergenic
1051194989 9:14554422-14554444 CCTCCTAGTTTGAAGCTAAAAGG + Intergenic
1051314990 9:15819462-15819484 ACCCATAGACTCAAAATAAAGGG + Intronic
1051840178 9:21387606-21387628 ACATATAGACTGAAGGTAAAGGG - Intergenic
1051990842 9:23150955-23150977 ACACATAGACTGAAATAAAAGGG - Intergenic
1052015534 9:23460721-23460743 ACTCATAGACTAAAAGTGAAGGG + Intergenic
1052408167 9:28088837-28088859 ACACATAGACTCAAAATAAAGGG + Intronic
1052689887 9:31803411-31803433 ACACATAGACTGAAAGTGAAGGG + Intergenic
1052703221 9:31962432-31962454 ACTCATAGGCTCAAAATAAAAGG + Intergenic
1052767162 9:32652675-32652697 ACACATAGACTCAAAATAAAGGG + Intergenic
1053088404 9:35249224-35249246 ACACATAGACTCAAAATAAAGGG - Intronic
1053205154 9:36179840-36179862 ACACATAGACTGAAAATAAAGGG + Intergenic
1053631295 9:39942750-39942772 TCTCATAGACTCAAGGTAAGGGG - Intergenic
1053774469 9:41520783-41520805 TCTCATAGACTCAAGGTAAGGGG + Intergenic
1053829515 9:42062472-42062494 ACACATAGACTGAAAGCAAAGGG - Intronic
1054212592 9:62307948-62307970 TCTCATAGACTCAAGGTAAGGGG + Intergenic
1054601044 9:67124980-67125002 ACACATAGACTGAAAGCAAAGGG + Intergenic
1054980511 9:71200742-71200764 ACACATAGACTCAAAATAAAAGG - Intronic
1055341318 9:75287046-75287068 ACACATAGGCTGAAAATAAAGGG - Intergenic
1055683995 9:78750712-78750734 ACACATAGACTGAAAGTGAAAGG - Intergenic
1056059225 9:82865719-82865741 AAACATAGACTGAAAGTAAAAGG + Intergenic
1056229642 9:84529831-84529853 ACACAGAGACTGAAAATAAAGGG - Intergenic
1056375179 9:86001737-86001759 ACTCATAGGCTCAAAATAAAGGG - Intronic
1056701100 9:88909229-88909251 ACACATAGACTCAAAATAAAGGG + Intergenic
1056803407 9:89709801-89709823 AAGCACAGACTGAAGCTCAAAGG + Intergenic
1057014274 9:91637129-91637151 CCTCATATACTGAAGGTAGAAGG - Intronic
1057970302 9:99549923-99549945 ACACATAGACTGAAAATAAAGGG - Intergenic
1058232737 9:102449489-102449511 ACACATAGACTGAAAATAAAGGG + Intergenic
1058243642 9:102598740-102598762 ACACATAGACTCAAAATAAAGGG - Intergenic
1058396949 9:104565189-104565211 GGTAATAGACTGAGGCTAAAAGG - Intergenic
1058614532 9:106811439-106811461 ACACATAGGCTGAAAATAAAGGG + Intergenic
1059719224 9:116943151-116943173 GCTCATAGACTGAAGGGAAGGGG + Intronic
1203408290 Un_KI270538v1:68034-68056 ACACATAGGCTCAAACTAAAAGG + Intergenic
1186192489 X:7079105-7079127 ACAGATAGATTGAAGATAAAAGG + Intronic
1186238367 X:7539244-7539266 ACACATAAACTGAAAGTAAAGGG + Intergenic
1186601893 X:11047650-11047672 ACACATAGACTGAAAATAAAGGG - Intergenic
1187594197 X:20753684-20753706 ACACATAGACTGAATATAAAGGG - Intergenic
1187729776 X:22240510-22240532 ACACATAGACTCAAAATAAAGGG + Intronic
1187838627 X:23461392-23461414 ATACATAGACTGAAAGTAAAGGG - Intergenic
1187845173 X:23527738-23527760 ACACATAAACTGAAAATAAAGGG + Intergenic
1187941268 X:24384507-24384529 ACACATAGACTGAAAGTAAAGGG - Intergenic
1188046078 X:25427306-25427328 ACATATAGACTGAAGACAAAGGG - Intergenic
1188077967 X:25802989-25803011 ACACATAGACTAAAATTAAAGGG - Intergenic
1188089343 X:25943746-25943768 ACACATAGACTGAAAGTGAAGGG + Intergenic
1188579427 X:31691569-31691591 ATGCATAGACTGAAAGTAAAGGG + Intronic
1188712531 X:33418172-33418194 ACTTATAGACTGAAGGTAAAGGG + Intergenic
1188733803 X:33686408-33686430 ACACACAGACTGAAATTAAAGGG - Intergenic
1188741891 X:33794025-33794047 ACACTTAGACTGAAAATAAAGGG - Intergenic
1188743965 X:33818790-33818812 ACACATAGACTGAAAGTAAAAGG - Intergenic
1188744612 X:33827597-33827619 ACACATAGACTCAAAATAAAAGG - Intergenic
1188747870 X:33869187-33869209 CCTAATAGAGGGAAGCTAAATGG - Intergenic
1188757742 X:33985278-33985300 ACATATAGACTGAAAGTAAAAGG - Intergenic
1188774166 X:34192072-34192094 ACCCATAAACTGAAAATAAAGGG - Intergenic
1188796973 X:34479387-34479409 ACCCATAGACTCAAAATAAAGGG - Intergenic
1188815062 X:34703109-34703131 ACACATAGACTGAAAATAGAGGG - Intergenic
1188846057 X:35073916-35073938 ACACATAGACTAAAAATAAAGGG - Intergenic
1188853968 X:35169379-35169401 ACACATAAACTGAAAATAAAGGG - Intergenic
1188915702 X:35907538-35907560 ACAAATAGACTGAAAATAAAGGG - Intergenic
1188998864 X:36920995-36921017 ACACACAGACTGAAAATAAAAGG - Intergenic
1189019831 X:37322981-37323003 ACACATAGACTAAAAATAAAGGG + Intergenic
1189406019 X:40723976-40723998 ATACATAGACTGAAAATAAAGGG + Intronic
1189564417 X:42226285-42226307 ACACATAGACTGAAAGTAAAGGG - Intergenic
1189584967 X:42450119-42450141 ACACATAGGCTGAAAATAAAGGG + Intergenic
1189690223 X:43609897-43609919 ACACATAGACTGAAAATAAAGGG - Intergenic
1189854154 X:45206694-45206716 ACACATAGACTGAAAATAAAGGG - Intergenic
1189878338 X:45461277-45461299 ACCCATAGGCTTAAGGTAAAGGG - Intergenic
1190015393 X:46822498-46822520 ACACATAGACTGAAAATAAAGGG + Intergenic
1190530627 X:51371310-51371332 ACATATAGACTGAAAATAAAGGG + Intergenic
1190587238 X:51958848-51958870 ACACATAGATTGAAAATAAAGGG - Intergenic
1190593506 X:52029375-52029397 ACACATAGACTCAAAATAAAGGG - Intergenic
1190607751 X:52162176-52162198 ACACATAGACTCAAAATAAAGGG + Intergenic
1190614962 X:52220837-52220859 ACACAAAGACTGAAAATAAAAGG + Intergenic
1190899345 X:54653965-54653987 ACACATAGACTGAAAATAAAGGG + Intergenic
1190901561 X:54679183-54679205 ACACATAGGCTCAAGATAAAGGG + Intergenic
1190907604 X:54743379-54743401 ACACATAGACTGCAAATAAAGGG - Intergenic
1190925194 X:54897144-54897166 ACATATAGACTGAAAGTAAAGGG + Intergenic
1190978857 X:55436442-55436464 ATGCATAGACTGAAAATAAAGGG + Intergenic
1191045513 X:56131760-56131782 ACACATAAACTTAAGGTAAAAGG + Intergenic
1191088497 X:56595541-56595563 ACTCATAGGCTCAAAATAAAGGG - Intergenic
1191125769 X:56952608-56952630 ACACATAGGCTCAAGATAAAGGG - Intergenic
1191169376 X:57425971-57425993 AATTATAGACTGAAGGTAATGGG + Intronic
1191646853 X:63491101-63491123 ACACAGAGACTGAAAATAAAGGG + Intergenic
1191784348 X:64901660-64901682 ACTCATAAACTTAAGGTAAAGGG - Intergenic
1191799715 X:65065010-65065032 ACACATAGGCTGAAAATAAAGGG - Intergenic
1191808527 X:65161631-65161653 ACACATAGACTCAAAATAAAAGG - Intergenic
1191814335 X:65226654-65226676 ACACATAGACTCAAAATAAAAGG + Intergenic
1191836755 X:65471372-65471394 TCTTATAGACTCAAGATAAATGG - Intronic
1191922608 X:66272445-66272467 ACTCATAGGCTCAAAATAAAGGG + Intergenic
1191957385 X:66659165-66659187 ACACATAGACTGAAAATAAAAGG + Intergenic
1191972353 X:66831025-66831047 ACACATAGGCTGAAAGTAAAAGG - Intergenic
1192013547 X:67301928-67301950 TCACATAGACTGAAGGTGAAGGG + Intergenic
1192061529 X:67832192-67832214 ACACATAGACTCAAAATAAAAGG + Intergenic
1192088258 X:68124013-68124035 ACACATAGACTGAAAATAAAAGG + Intronic
1192135357 X:68592263-68592285 ACACATAGACTGAAAATAAAGGG + Intergenic
1192254110 X:69441094-69441116 ACTCATAGGCTCAAAATAAAGGG - Intergenic
1192304172 X:69941641-69941663 AAACATAGACTGAAAATAAAGGG - Intronic
1192406341 X:70890058-70890080 ACACACAGACTGAAAATAAAGGG + Intronic
1192417533 X:70996456-70996478 ACACATAGACTGAAAATAAAGGG - Intergenic
1192680172 X:73244525-73244547 ACACATAGACTGAAAATAAAGGG + Intergenic
1192707601 X:73542711-73542733 ACACATAGACTCAAAATAAAGGG + Intergenic
1192753525 X:74020242-74020264 ACCCATTGACTCAAGGTAAAGGG + Intergenic
1192784358 X:74322537-74322559 GCTCAGAGACAGAAGCAAAAAGG + Intergenic
1192802321 X:74478357-74478379 ACACATAGACTCAAAATAAAGGG - Intronic
1192804277 X:74495771-74495793 GCTCAGAGACAGAAGCAAAAAGG - Intronic
1192812788 X:74561778-74561800 ACACATAGACTGAAAATAAAGGG + Intergenic
1192821516 X:74650918-74650940 ACTCATAGATTGAAAATAAAGGG - Intergenic
1192858262 X:75037490-75037512 ACGTATAGACTGAAAATAAAGGG - Intergenic
1192875009 X:75220269-75220291 ACATATAGACTGAAAATAAAAGG - Intergenic
1192887646 X:75352938-75352960 ACACATAGACTGAAAATAAAGGG - Intergenic
1192908265 X:75576009-75576031 ACACATAGCCTGAATATAAAGGG - Intergenic
1192943020 X:75933367-75933389 ACACATAGGCTGAAAATAAAGGG - Intergenic
1192984042 X:76377421-76377443 ACACATAGGCTGAAAATAAAAGG - Intergenic
1192998135 X:76533995-76534017 ACACATAGACTAAAAATAAATGG - Intergenic
1193017583 X:76752988-76753010 ACATATAGACTGAAAGTAAAGGG + Intergenic
1193028233 X:76868986-76869008 ACAGATAGACTGAAAATAAAGGG + Intergenic
1193063994 X:77237858-77237880 ACATATAGACTAAAGATAAAAGG + Intergenic
1193066962 X:77270304-77270326 ACACATAGGCTCAAACTAAAGGG + Intergenic
1193078958 X:77385727-77385749 ACACATAGACTGAAAATAAAGGG + Intergenic
1193098586 X:77581340-77581362 ACACATAGGCTGAAAATAAAGGG + Intronic
1193140946 X:78026209-78026231 ACTCATAGGTTGAAGGTGAAGGG + Intronic
1193219685 X:78909644-78909666 AAACATAGACTGAAAATAAAGGG - Intergenic
1193252823 X:79312082-79312104 ACACAGAGACTGAAAATAAATGG + Intergenic
1193289068 X:79750434-79750456 ACACATAGACTGAAAACAAAGGG - Intergenic
1193337155 X:80304210-80304232 ACACATAGACTGAAAAAAAAAGG - Intergenic
1193343556 X:80380827-80380849 ACACATAGACTCAAAATAAAGGG - Intronic
1193351058 X:80464810-80464832 ACACATAGACTCAAAATAAAGGG + Intergenic
1193354570 X:80502510-80502532 TCTTATAGACTCAAGGTAAAGGG + Intergenic
1193357958 X:80544248-80544270 ACCCATAGGCTGAAGGCAAAGGG + Intergenic
1193457745 X:81752025-81752047 ACACATAGACTCAAAATAAAGGG - Intergenic
1193471149 X:81906203-81906225 TCTCACAGACTGAAGGTAAAGGG - Intergenic
1193541046 X:82773299-82773321 ACAAATAAACTGAAGATAAAAGG - Intergenic
1193561668 X:83024986-83025008 ACATATAGACTGAAAATAAAGGG + Intergenic
1193593762 X:83421381-83421403 ACTCATAGTCTGAAAATAAAGGG + Intergenic
1193605689 X:83565586-83565608 ACACATAGGCTGAAAATAAAGGG - Intergenic
1193642673 X:84030415-84030437 ACACATAGACTGACAATAAAAGG + Intergenic
1193664824 X:84302756-84302778 ACACATAGACTGAAAGTAAAGGG + Intergenic
1193665657 X:84312633-84312655 CCACATAGACTGAAAATAAAGGG + Intergenic
1193673785 X:84421692-84421714 ACACATAGGCTGAAAATAAAGGG + Intronic
1193721778 X:84995417-84995439 ACACATAGACTGAAGGTAAAAGG + Intergenic
1193742585 X:85234996-85235018 ACACATAGACTGAAAATAAAGGG + Intergenic
1193755204 X:85400746-85400768 ACCCATAGACTGAAAATTAAGGG - Intergenic
1193770118 X:85578180-85578202 ACTCATAGGCTCAAAGTAAAGGG + Intergenic
1193789997 X:85806210-85806232 ACCCATAGACTCAAAATAAAGGG - Intergenic
1193821266 X:86168401-86168423 ACACAAAGACTGAAGCTAAAGGG - Intronic
1193859151 X:86642229-86642251 ACTCATAGGCTCAAAATAAAGGG + Intronic
1193930821 X:87549047-87549069 ACACATGGACTGAAAATAAAGGG + Intronic
1193999169 X:88405976-88405998 ACTCATAGGCTCAAAATAAAGGG + Intergenic
1194016448 X:88626917-88626939 ACACATAGACTCAAAATAAAGGG + Intergenic
1194056020 X:89132873-89132895 ACATATAGACTGAAAATAAAGGG - Intergenic
1194106941 X:89781120-89781142 ACACATAGACTGAAAGTAAAGGG + Intergenic
1194137327 X:90162293-90162315 ACTCATAGACTCAAAATACAGGG + Intergenic
1194192609 X:90856199-90856221 ACATATAGACTGATGGTAAAGGG - Intergenic
1194212919 X:91090942-91090964 ACTCATAGGCTCAAAATAAAGGG - Intergenic
1194218561 X:91163942-91163964 ACACACAGACTGAAAATAAAGGG - Intergenic
1194260423 X:91687591-91687613 ACACATAGACTCAAAGTAAAGGG + Intergenic
1194285397 X:92004743-92004765 ACACATAGACTGAAAATTAAAGG - Intronic
1194344672 X:92749056-92749078 ACTGATAGACTTAAAATAAAGGG - Intergenic
1194358166 X:92914551-92914573 ACACATAGACTGAAAATAAAGGG - Intergenic
1194479134 X:94398729-94398751 ACACATAGACTGAAAATAAAGGG - Intergenic
1194494981 X:94603338-94603360 ACTCATAGTTTGAAAATAAAAGG + Intergenic
1194608773 X:96014321-96014343 ACACATAGATTGAAAATAAAGGG - Intergenic
1194632710 X:96305496-96305518 ACACATAGACTGAAAGTGAAAGG - Intergenic
1194736427 X:97517465-97517487 AATCATTGACAGAACCTAAAGGG + Intronic
1194772079 X:97917808-97917830 ACACATAGACTCAAAATAAAGGG + Intergenic
1194787387 X:98103757-98103779 ACACATAAACTGAAAATAAAAGG - Intergenic
1194854478 X:98912811-98912833 ACTCATAGGCTCAAAATAAAGGG - Intergenic
1194892330 X:99395671-99395693 ACACATAGACTGAAAATAAATGG - Intergenic
1194893765 X:99413965-99413987 ACTCATAGGCTCAAAGTAAAGGG - Intergenic
1194900209 X:99500180-99500202 ACTCATAGACTCAAAATAAAGGG + Intergenic
1194926640 X:99833569-99833591 ACACATAGACTGAAAATAAAGGG + Intergenic
1194929615 X:99869851-99869873 ACACATAGACTGAAAATAAAGGG + Intergenic
1194942021 X:100022262-100022284 ACACATAGTCTGAAAATAAAGGG + Intergenic
1195015291 X:100773482-100773504 ACACATAGACTGAAAGTGAAGGG - Intergenic
1195396391 X:104414991-104415013 ACACATAGACTGATAATAAAGGG + Intergenic
1195421040 X:104675968-104675990 ACACATAGACTCAAAATAAAAGG - Intronic
1195440509 X:104893656-104893678 ACACATAGACTCAACATAAAGGG - Intronic
1195456605 X:105076912-105076934 ACACATAGACTCAAAATAAAGGG - Intronic
1195500453 X:105592295-105592317 ACCCATAGACTCAAAGTAAAAGG - Intronic
1195558553 X:106256083-106256105 ACACATAGACAGAAAATAAAGGG - Intergenic
1195568456 X:106372396-106372418 ACTCATAGGCTCAAAATAAAGGG + Intergenic
1195601491 X:106753729-106753751 ACACATAGACTGAATATAAAAGG + Intronic
1195786500 X:108529681-108529703 ACATATAGACTGAAAGTAAAGGG + Intronic
1195834213 X:109094501-109094523 ACCCATAGACTCAAAGTAAAGGG - Intergenic
1195977973 X:110548174-110548196 ACACATAGGCTCAAGATAAAGGG + Intergenic
1195987240 X:110643887-110643909 ACACATAGGCTCAAGATAAAGGG - Intergenic
1196148999 X:112351736-112351758 ACACATAGGCTGAAAATAAAGGG - Intergenic
1196218451 X:113083309-113083331 ACACATACACTGAAAATAAAGGG + Intergenic
1196248749 X:113432112-113432134 ACACATAGACTGAAAATAAGAGG + Intergenic
1196304892 X:114089713-114089735 ACACATAGACTGAAAATAAAGGG + Intergenic
1196385291 X:115141941-115141963 ACACATAGACTGAGAATAAAGGG + Intronic
1196478592 X:116119263-116119285 ACACATAGACTGTAAATAAAGGG - Intergenic
1196578885 X:117356399-117356421 ACACTTAGACTGAAAATAAAGGG - Intergenic
1196599771 X:117588871-117588893 ACACATAGACTGAAAATAAATGG - Intergenic
1196982970 X:121236131-121236153 ACACATAGCCTGAAAATAAAGGG - Intergenic
1196986400 X:121277264-121277286 ATACATAGACTGAAAATAAAGGG + Intergenic
1197027906 X:121777585-121777607 TCTTGTAGACTGAAGGTAAAGGG - Intergenic
1197039917 X:121924315-121924337 ACTCATAGGCTCAAAATAAAGGG + Intergenic
1197052340 X:122074838-122074860 ACACATAGACTGAAAATAAAGGG - Intergenic
1197069774 X:122282028-122282050 ACAGATAGACTGAAAATAAAGGG + Intergenic
1197298957 X:124755357-124755379 ACACATAGCCTGAAAATAAAAGG - Intronic
1197302735 X:124801454-124801476 ACACATAGACTCAAAATAAAGGG - Intronic
1197362929 X:125529861-125529883 AAACATAGACTGAAAATAAAGGG - Intergenic
1197403048 X:126016694-126016716 ACACATAGTCTAAAACTAAAGGG - Intergenic
1197438218 X:126458521-126458543 ACACATAGACTAAAACTAAAAGG + Intergenic
1197481994 X:126997844-126997866 ACACATAGAGTGAAAATAAAGGG + Intergenic
1197491277 X:127120571-127120593 ACACATAGGCTGAAAATAAAAGG - Intergenic
1197498501 X:127216013-127216035 ACACATAGACTCAAAATAAAAGG + Intergenic
1197502024 X:127254334-127254356 ACACATAGGCTGAAAATAAAAGG - Intergenic
1197522924 X:127521793-127521815 ACACATAGACTCAAAATAAAGGG + Intergenic
1197524260 X:127542838-127542860 ACACATAGCCTGAAAATAAAGGG - Intergenic
1197567409 X:128104424-128104446 ACACATAGCCTGAAAATAAAAGG - Intergenic
1197602369 X:128545515-128545537 ACACATAGATTGAAAATAAAGGG - Intergenic
1197677886 X:129349979-129350001 ACACATAGACTGAAAATAAAGGG + Intergenic
1197876314 X:131112076-131112098 ACACAAAGACTGAAAATAAAGGG - Intergenic
1198027411 X:132720698-132720720 ACAAATAGACTGAAAATAAAGGG + Intronic
1198072384 X:133161603-133161625 ACACATAGACTCAAAATAAAGGG + Intergenic
1198190729 X:134302118-134302140 ACACGTAGACTGAAAATAAAGGG + Intergenic
1198295162 X:135280356-135280378 ACACATAGGCTCAAGATAAAGGG - Intronic
1198435185 X:136610086-136610108 ACTAATATACTGAAACTGAAAGG - Intergenic
1198514957 X:137397728-137397750 ACACATAGACTGAAAATAAAGGG - Intergenic
1198571504 X:137961938-137961960 ACACATAGACTCAAAATAAAGGG + Intergenic
1198612216 X:138414267-138414289 ACACATAGACTGAAAATAAAGGG + Intergenic
1198664632 X:139007122-139007144 ACACATAGACTGAAAATGAAAGG + Intronic
1198696980 X:139352367-139352389 ACACATAGACTGAAAATAAAGGG - Intergenic
1198817832 X:140611790-140611812 ATGCATAGACTGAAAATAAAGGG - Intergenic
1198855900 X:141015902-141015924 ACACATAGACTGAAAATAAAGGG - Intergenic
1198856017 X:141017632-141017654 ACACATAGGCTGAAAATAAAGGG - Intergenic
1198876229 X:141230236-141230258 ACACATAGACTGAAAATAAAGGG + Intergenic
1198906674 X:141569735-141569757 ACACATAGGCTGAAAATAAAGGG + Intergenic
1198906793 X:141571465-141571487 ACACATAGACTGAAAATAAAGGG + Intergenic
1198916970 X:141683407-141683429 ACACATAGGCTGAAAATAAAGGG + Intronic
1198956649 X:142139090-142139112 ACACAGAGACTGAAAATAAAGGG + Intergenic
1199035763 X:143049539-143049561 ACACATAGACTGAAAATAAAGGG - Intergenic
1199076000 X:143527242-143527264 ACACATACACTGAAAATAAAGGG - Intergenic
1199095964 X:143738963-143738985 ACACATAGACTGAAATTAAAGGG + Intergenic
1199217689 X:145279822-145279844 ACACATAGAATGAAAATAAAGGG - Intergenic
1199341720 X:146686345-146686367 ACACATAGATTGAAAATAAAGGG - Intergenic
1199378499 X:147140535-147140557 ACACATAGACTGAAAACAAAGGG - Intergenic
1199415335 X:147575642-147575664 ACACACAGACTGAAGACAAAGGG + Intergenic
1199442761 X:147887222-147887244 ACACACAGACTGAAAATAAAGGG - Intergenic
1199755220 X:150857966-150857988 ACATATAGACTGAAAGTAAAGGG + Intronic
1199796424 X:151202093-151202115 ACACATAGACTCAAAATAAAGGG + Intergenic
1199913205 X:152309906-152309928 ACTCATAGGCTCAAAGTAAAGGG + Intronic
1200360982 X:155605877-155605899 ACCCATAGACTCAAAGTAAATGG + Intronic
1200379762 X:155822507-155822529 ACACACAGACTGAAAATAAAGGG + Intergenic
1200458904 Y:3428979-3429001 ACACATAGACTGAAAGTAAAGGG + Intergenic
1200483060 Y:3732233-3732255 ACTCATAGACTCAAAATACAGGG + Intergenic
1200537836 Y:4420889-4420911 ACACATAGGCTGAAAATAAAAGG + Intergenic
1200539238 Y:4438644-4438666 ACATATAGACTGATGGTAAAGGG - Intergenic
1200555074 Y:4627699-4627721 ACACACAGACTGAAAATAAAGGG - Intergenic
1200653018 Y:5865694-5865716 ACTGATAGACTTAAAATAAAGGG - Intergenic
1200666347 Y:6030206-6030228 ACACATAGACTGAAAATAAAGGG - Intergenic
1200871166 Y:8100345-8100367 ACACATAGGCTCAAACTAAAGGG - Intergenic
1200956023 Y:8946916-8946938 ACACATAGACTCAAAGTAAAGGG - Intergenic
1201308459 Y:12571825-12571847 ACACATAGACTCAAAATAAAGGG + Intergenic
1201389956 Y:13487291-13487313 ACTCATAGCCTCAAAATAAAGGG - Intergenic
1201397869 Y:13568340-13568362 ACACATAGACTGAAAACAAAAGG - Intergenic
1201413473 Y:13724210-13724232 ACACATAGGCTGAAAATAAAAGG + Intergenic
1201969715 Y:19778108-19778130 ACTCATAGGCTCAAAATAAAGGG + Intergenic
1202088041 Y:21159701-21159723 ACACATAGACTCAAAATAAAAGG - Intergenic
1202270383 Y:23066518-23066540 GCACATAGACTGAAGACAAATGG + Intergenic
1202295644 Y:23354164-23354186 GCACATAGACTGAAGACAAATGG - Intergenic
1202384437 Y:24311652-24311674 ACACAAAGACTGAAGCTTTAAGG + Intergenic
1202423377 Y:24700263-24700285 GCACATAGACTGAAGACAAATGG + Intergenic
1202447412 Y:24969823-24969845 GCACATAGACTGAAGACAAATGG - Intergenic
1202486346 Y:25358470-25358492 ACACAAAGACTGAAGCTTTAAGG - Intergenic
1202602124 Y:26604036-26604058 ACACATAGACTCAAAATAAAAGG + Intergenic