ID: 1010462268 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 6:76126860-76126882 |
| Sequence | CTGCACTTGAAGAGGTCACT TGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1010462265_1010462268 | 5 | Left | 1010462265 | 6:76126832-76126854 | CCTGGTCATGAGTTTTCCAGGGA | No data | ||
| Right | 1010462268 | 6:76126860-76126882 | CTGCACTTGAAGAGGTCACTTGG | No data | ||||
| 1010462262_1010462268 | 21 | Left | 1010462262 | 6:76126816-76126838 | CCATTGAGATTGATTTCCTGGTC | No data | ||
| Right | 1010462268 | 6:76126860-76126882 | CTGCACTTGAAGAGGTCACTTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1010462268 | Original CRISPR | CTGCACTTGAAGAGGTCACT TGG | Intergenic | ||
| No off target data available for this crispr | |||||