ID: 1010462268

View in Genome Browser
Species Human (GRCh38)
Location 6:76126860-76126882
Sequence CTGCACTTGAAGAGGTCACT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1010462265_1010462268 5 Left 1010462265 6:76126832-76126854 CCTGGTCATGAGTTTTCCAGGGA No data
Right 1010462268 6:76126860-76126882 CTGCACTTGAAGAGGTCACTTGG No data
1010462262_1010462268 21 Left 1010462262 6:76126816-76126838 CCATTGAGATTGATTTCCTGGTC No data
Right 1010462268 6:76126860-76126882 CTGCACTTGAAGAGGTCACTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1010462268 Original CRISPR CTGCACTTGAAGAGGTCACT TGG Intergenic
No off target data available for this crispr