ID: 1010465646

View in Genome Browser
Species Human (GRCh38)
Location 6:76165256-76165278
Sequence CTCCATGAGAACGTGCACAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1010465646_1010465648 0 Left 1010465646 6:76165256-76165278 CCAGTGTGCACGTTCTCATGGAG No data
Right 1010465648 6:76165279-76165301 AAAAGCGTGGCCAGATCATCCGG No data
1010465646_1010465650 4 Left 1010465646 6:76165256-76165278 CCAGTGTGCACGTTCTCATGGAG No data
Right 1010465650 6:76165283-76165305 GCGTGGCCAGATCATCCGGGTGG No data
1010465646_1010465653 14 Left 1010465646 6:76165256-76165278 CCAGTGTGCACGTTCTCATGGAG No data
Right 1010465653 6:76165293-76165315 ATCATCCGGGTGGACACGTTGGG No data
1010465646_1010465655 25 Left 1010465646 6:76165256-76165278 CCAGTGTGCACGTTCTCATGGAG No data
Right 1010465655 6:76165304-76165326 GGACACGTTGGGATTCATGAAGG No data
1010465646_1010465652 13 Left 1010465646 6:76165256-76165278 CCAGTGTGCACGTTCTCATGGAG No data
Right 1010465652 6:76165292-76165314 GATCATCCGGGTGGACACGTTGG No data
1010465646_1010465649 1 Left 1010465646 6:76165256-76165278 CCAGTGTGCACGTTCTCATGGAG No data
Right 1010465649 6:76165280-76165302 AAAGCGTGGCCAGATCATCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1010465646 Original CRISPR CTCCATGAGAACGTGCACAC TGG (reversed) Intergenic
No off target data available for this crispr