ID: 1010466506

View in Genome Browser
Species Human (GRCh38)
Location 6:76173128-76173150
Sequence AGGAATGTATAGGTGGAGCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1010466497_1010466506 25 Left 1010466497 6:76173080-76173102 CCTGCACATGGTATAATGCGAGA No data
Right 1010466506 6:76173128-76173150 AGGAATGTATAGGTGGAGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1010466506 Original CRISPR AGGAATGTATAGGTGGAGCA TGG Intergenic
No off target data available for this crispr