ID: 1010483036

View in Genome Browser
Species Human (GRCh38)
Location 6:76377801-76377823
Sequence CTCTCAGCAGAAACTCAGAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1010483036_1010483043 28 Left 1010483036 6:76377801-76377823 CCCTTCTGAGTTTCTGCTGAGAG No data
Right 1010483043 6:76377852-76377874 TGTGACCTGGTCTTTCTCTCTGG No data
1010483036_1010483039 -3 Left 1010483036 6:76377801-76377823 CCCTTCTGAGTTTCTGCTGAGAG No data
Right 1010483039 6:76377821-76377843 GAGGTCTGCCGTTAGTCTGATGG No data
1010483036_1010483042 15 Left 1010483036 6:76377801-76377823 CCCTTCTGAGTTTCTGCTGAGAG No data
Right 1010483042 6:76377839-76377861 GATGGGCTTTGTATGTGACCTGG No data
1010483036_1010483040 -2 Left 1010483036 6:76377801-76377823 CCCTTCTGAGTTTCTGCTGAGAG No data
Right 1010483040 6:76377822-76377844 AGGTCTGCCGTTAGTCTGATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1010483036 Original CRISPR CTCTCAGCAGAAACTCAGAA GGG (reversed) Intergenic
No off target data available for this crispr