ID: 1010485669

View in Genome Browser
Species Human (GRCh38)
Location 6:76410457-76410479
Sequence AAGAAGAAGAAGAAGGAAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 7563
Summary {0: 12, 1: 84, 2: 343, 3: 1478, 4: 5646}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1010485669_1010485673 21 Left 1010485669 6:76410457-76410479 CCTTCTTCCTTCTTCTTCTTCTT 0: 12
1: 84
2: 343
3: 1478
4: 5646
Right 1010485673 6:76410501-76410523 GGAGTGTGGCTCTGTCACCCAGG 0: 7
1: 1017
2: 27283
3: 91015
4: 131404
1010485669_1010485672 7 Left 1010485669 6:76410457-76410479 CCTTCTTCCTTCTTCTTCTTCTT 0: 12
1: 84
2: 343
3: 1478
4: 5646
Right 1010485672 6:76410487-76410509 TTTTTTTTTGAGTTGGAGTGTGG No data
1010485669_1010485674 25 Left 1010485669 6:76410457-76410479 CCTTCTTCCTTCTTCTTCTTCTT 0: 12
1: 84
2: 343
3: 1478
4: 5646
Right 1010485674 6:76410505-76410527 TGTGGCTCTGTCACCCAGGCTGG 0: 23
1: 2729
2: 56439
3: 147259
4: 175060
1010485669_1010485671 0 Left 1010485669 6:76410457-76410479 CCTTCTTCCTTCTTCTTCTTCTT 0: 12
1: 84
2: 343
3: 1478
4: 5646
Right 1010485671 6:76410480-76410502 CTTTTTTTTTTTTTTTGAGTTGG 0: 117
1: 8867
2: 100034
3: 71307
4: 116018

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1010485669 Original CRISPR AAGAAGAAGAAGAAGGAAGA AGG (reversed) Intergenic
Too many off-targets to display for this crispr