ID: 1010487092

View in Genome Browser
Species Human (GRCh38)
Location 6:76427792-76427814
Sequence CAACACAAGGAGAAGAGGTT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1010487088_1010487092 15 Left 1010487088 6:76427754-76427776 CCAAATAGAGAGATGCACTTACA No data
Right 1010487092 6:76427792-76427814 CAACACAAGGAGAAGAGGTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1010487092 Original CRISPR CAACACAAGGAGAAGAGGTT GGG Intergenic
No off target data available for this crispr