ID: 1010496364

View in Genome Browser
Species Human (GRCh38)
Location 6:76537714-76537736
Sequence CTCTCTTGCCCCAGTTCTGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1010496355_1010496364 13 Left 1010496355 6:76537678-76537700 CCATAGCCTGGGCCAGTAGTGGG No data
Right 1010496364 6:76537714-76537736 CTCTCTTGCCCCAGTTCTGGTGG No data
1010496360_1010496364 1 Left 1010496360 6:76537690-76537712 CCAGTAGTGGGGGAATGCATATC No data
Right 1010496364 6:76537714-76537736 CTCTCTTGCCCCAGTTCTGGTGG No data
1010496359_1010496364 7 Left 1010496359 6:76537684-76537706 CCTGGGCCAGTAGTGGGGGAATG No data
Right 1010496364 6:76537714-76537736 CTCTCTTGCCCCAGTTCTGGTGG No data
1010496353_1010496364 22 Left 1010496353 6:76537669-76537691 CCTCAGTGTCCATAGCCTGGGCC No data
Right 1010496364 6:76537714-76537736 CTCTCTTGCCCCAGTTCTGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1010496364 Original CRISPR CTCTCTTGCCCCAGTTCTGG TGG Intergenic
No off target data available for this crispr