ID: 1010497654

View in Genome Browser
Species Human (GRCh38)
Location 6:76554736-76554758
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1010497654_1010497657 20 Left 1010497654 6:76554736-76554758 CCCACATTTCTGCTTCATAGCAG No data
Right 1010497657 6:76554779-76554801 CAAGACAACTTAGTCAGTTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1010497654 Original CRISPR CTGCTATGAAGCAGAAATGT GGG (reversed) Intergenic
No off target data available for this crispr