ID: 1010503049

View in Genome Browser
Species Human (GRCh38)
Location 6:76624801-76624823
Sequence GGGTATTCAATTACAAAAAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1010503049_1010503052 8 Left 1010503049 6:76624801-76624823 CCTCTTTTTGTAATTGAATACCC No data
Right 1010503052 6:76624832-76624854 TTTCTCCTGCCTGATTGCCCTGG 0: 1404
1: 6333
2: 8242
3: 5226
4: 4230

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1010503049 Original CRISPR GGGTATTCAATTACAAAAAG AGG (reversed) Intergenic
No off target data available for this crispr