ID: 1010505068

View in Genome Browser
Species Human (GRCh38)
Location 6:76646998-76647020
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1010505068_1010505071 -2 Left 1010505068 6:76646998-76647020 CCTCCCTCAGGCTGCTTCTGGTA No data
Right 1010505071 6:76647019-76647041 TAAAAATTACTTTATTGATTAGG No data
1010505068_1010505072 10 Left 1010505068 6:76646998-76647020 CCTCCCTCAGGCTGCTTCTGGTA No data
Right 1010505072 6:76647031-76647053 TATTGATTAGGAAGCCCATCAGG No data
1010505068_1010505073 20 Left 1010505068 6:76646998-76647020 CCTCCCTCAGGCTGCTTCTGGTA No data
Right 1010505073 6:76647041-76647063 GAAGCCCATCAGGAAAGAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1010505068 Original CRISPR TACCAGAAGCAGCCTGAGGG AGG (reversed) Intergenic
No off target data available for this crispr