ID: 1010508352

View in Genome Browser
Species Human (GRCh38)
Location 6:76687634-76687656
Sequence CTGTGGAATTAGAGGTATTA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1010508347_1010508352 -3 Left 1010508347 6:76687614-76687636 CCTCACATTGTTCCTCTGACCTG No data
Right 1010508352 6:76687634-76687656 CTGTGGAATTAGAGGTATTACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1010508352 Original CRISPR CTGTGGAATTAGAGGTATTA CGG Intergenic
No off target data available for this crispr