ID: 1010508841

View in Genome Browser
Species Human (GRCh38)
Location 6:76692243-76692265
Sequence TTTCTGAAGGGGAATTTGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1010508835_1010508841 28 Left 1010508835 6:76692192-76692214 CCAACTAAAGTTTGGACAAGCAA No data
Right 1010508841 6:76692243-76692265 TTTCTGAAGGGGAATTTGGGTGG No data
1010508834_1010508841 29 Left 1010508834 6:76692191-76692213 CCCAACTAAAGTTTGGACAAGCA No data
Right 1010508841 6:76692243-76692265 TTTCTGAAGGGGAATTTGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1010508841 Original CRISPR TTTCTGAAGGGGAATTTGGG TGG Intergenic
No off target data available for this crispr