ID: 1010508841 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 6:76692243-76692265 |
Sequence | TTTCTGAAGGGGAATTTGGG TGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | No data | |||
Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1010508835_1010508841 | 28 | Left | 1010508835 | 6:76692192-76692214 | CCAACTAAAGTTTGGACAAGCAA | No data | ||
Right | 1010508841 | 6:76692243-76692265 | TTTCTGAAGGGGAATTTGGGTGG | No data | ||||
1010508834_1010508841 | 29 | Left | 1010508834 | 6:76692191-76692213 | CCCAACTAAAGTTTGGACAAGCA | No data | ||
Right | 1010508841 | 6:76692243-76692265 | TTTCTGAAGGGGAATTTGGGTGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1010508841 | Original CRISPR | TTTCTGAAGGGGAATTTGGG TGG | Intergenic | ||
No off target data available for this crispr |