ID: 1010510591

View in Genome Browser
Species Human (GRCh38)
Location 6:76713768-76713790
Sequence TCACCATGTTGGCCATGAAT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1010510584_1010510591 25 Left 1010510584 6:76713720-76713742 CCTGCCATCACGCCTGGATAATT No data
Right 1010510591 6:76713768-76713790 TCACCATGTTGGCCATGAATAGG No data
1010510585_1010510591 21 Left 1010510585 6:76713724-76713746 CCATCACGCCTGGATAATTTTTT No data
Right 1010510591 6:76713768-76713790 TCACCATGTTGGCCATGAATAGG No data
1010510586_1010510591 13 Left 1010510586 6:76713732-76713754 CCTGGATAATTTTTTATTTTTAA No data
Right 1010510591 6:76713768-76713790 TCACCATGTTGGCCATGAATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1010510591 Original CRISPR TCACCATGTTGGCCATGAAT AGG Intergenic
No off target data available for this crispr