ID: 1010514254

View in Genome Browser
Species Human (GRCh38)
Location 6:76753724-76753746
Sequence GACCTACCCTGGGACAGTGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1010514244_1010514254 23 Left 1010514244 6:76753678-76753700 CCTAATGTTCCTAAATCCAGGTT No data
Right 1010514254 6:76753724-76753746 GACCTACCCTGGGACAGTGAGGG No data
1010514248_1010514254 7 Left 1010514248 6:76753694-76753716 CCAGGTTCTGGCTACCAGATGGC No data
Right 1010514254 6:76753724-76753746 GACCTACCCTGGGACAGTGAGGG No data
1010514246_1010514254 14 Left 1010514246 6:76753687-76753709 CCTAAATCCAGGTTCTGGCTACC No data
Right 1010514254 6:76753724-76753746 GACCTACCCTGGGACAGTGAGGG No data
1010514250_1010514254 -7 Left 1010514250 6:76753708-76753730 CCAGATGGCATTTCTGGACCTAC No data
Right 1010514254 6:76753724-76753746 GACCTACCCTGGGACAGTGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1010514254 Original CRISPR GACCTACCCTGGGACAGTGA GGG Intergenic
No off target data available for this crispr