ID: 1010515713

View in Genome Browser
Species Human (GRCh38)
Location 6:76770681-76770703
Sequence TCTTATCTGTAGAAGAGGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1010515713_1010515716 -8 Left 1010515713 6:76770681-76770703 CCTTTCCTCTTCTACAGATAAGA No data
Right 1010515716 6:76770696-76770718 AGATAAGATAATGTCTGACAGGG No data
1010515713_1010515715 -9 Left 1010515713 6:76770681-76770703 CCTTTCCTCTTCTACAGATAAGA No data
Right 1010515715 6:76770695-76770717 CAGATAAGATAATGTCTGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1010515713 Original CRISPR TCTTATCTGTAGAAGAGGAA AGG (reversed) Intergenic
No off target data available for this crispr