ID: 1010516612

View in Genome Browser
Species Human (GRCh38)
Location 6:76780697-76780719
Sequence GACACTCTAGTGACTTTAAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1010516612_1010516617 27 Left 1010516612 6:76780697-76780719 CCATTTAAAGTCACTAGAGTGTC No data
Right 1010516617 6:76780747-76780769 TGCTTACATCTCCAGGGCAGTGG No data
1010516612_1010516619 29 Left 1010516612 6:76780697-76780719 CCATTTAAAGTCACTAGAGTGTC No data
Right 1010516619 6:76780749-76780771 CTTACATCTCCAGGGCAGTGGGG No data
1010516612_1010516613 -7 Left 1010516612 6:76780697-76780719 CCATTTAAAGTCACTAGAGTGTC No data
Right 1010516613 6:76780713-76780735 GAGTGTCACTAAAGAATAAGTGG No data
1010516612_1010516616 21 Left 1010516612 6:76780697-76780719 CCATTTAAAGTCACTAGAGTGTC No data
Right 1010516616 6:76780741-76780763 TGTACTTGCTTACATCTCCAGGG No data
1010516612_1010516614 -6 Left 1010516612 6:76780697-76780719 CCATTTAAAGTCACTAGAGTGTC No data
Right 1010516614 6:76780714-76780736 AGTGTCACTAAAGAATAAGTGGG No data
1010516612_1010516615 20 Left 1010516612 6:76780697-76780719 CCATTTAAAGTCACTAGAGTGTC No data
Right 1010516615 6:76780740-76780762 TTGTACTTGCTTACATCTCCAGG No data
1010516612_1010516618 28 Left 1010516612 6:76780697-76780719 CCATTTAAAGTCACTAGAGTGTC No data
Right 1010516618 6:76780748-76780770 GCTTACATCTCCAGGGCAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1010516612 Original CRISPR GACACTCTAGTGACTTTAAA TGG (reversed) Intergenic
No off target data available for this crispr