ID: 1010516615

View in Genome Browser
Species Human (GRCh38)
Location 6:76780740-76780762
Sequence TTGTACTTGCTTACATCTCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1010516612_1010516615 20 Left 1010516612 6:76780697-76780719 CCATTTAAAGTCACTAGAGTGTC No data
Right 1010516615 6:76780740-76780762 TTGTACTTGCTTACATCTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1010516615 Original CRISPR TTGTACTTGCTTACATCTCC AGG Intergenic
No off target data available for this crispr