ID: 1010516857

View in Genome Browser
Species Human (GRCh38)
Location 6:76784042-76784064
Sequence CTGGAATCAAGGAGATGATC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1010516857_1010516861 21 Left 1010516857 6:76784042-76784064 CCAGATCATCTCCTTGATTCCAG No data
Right 1010516861 6:76784086-76784108 GCTGATATCTAGATATCTAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1010516857 Original CRISPR CTGGAATCAAGGAGATGATC TGG (reversed) Intergenic
No off target data available for this crispr