ID: 1010516861

View in Genome Browser
Species Human (GRCh38)
Location 6:76784086-76784108
Sequence GCTGATATCTAGATATCTAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1010516856_1010516861 22 Left 1010516856 6:76784041-76784063 CCCAGATCATCTCCTTGATTCCA No data
Right 1010516861 6:76784086-76784108 GCTGATATCTAGATATCTAATGG No data
1010516858_1010516861 10 Left 1010516858 6:76784053-76784075 CCTTGATTCCAGACTCACATATT No data
Right 1010516861 6:76784086-76784108 GCTGATATCTAGATATCTAATGG No data
1010516855_1010516861 26 Left 1010516855 6:76784037-76784059 CCAGCCCAGATCATCTCCTTGAT No data
Right 1010516861 6:76784086-76784108 GCTGATATCTAGATATCTAATGG No data
1010516857_1010516861 21 Left 1010516857 6:76784042-76784064 CCAGATCATCTCCTTGATTCCAG No data
Right 1010516861 6:76784086-76784108 GCTGATATCTAGATATCTAATGG No data
1010516859_1010516861 2 Left 1010516859 6:76784061-76784083 CCAGACTCACATATTGAATTGCC No data
Right 1010516861 6:76784086-76784108 GCTGATATCTAGATATCTAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1010516861 Original CRISPR GCTGATATCTAGATATCTAA TGG Intergenic
No off target data available for this crispr