ID: 1010518718

View in Genome Browser
Species Human (GRCh38)
Location 6:76806593-76806615
Sequence CAAAATCTGAGATGTTTAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1010518718_1010518720 15 Left 1010518718 6:76806593-76806615 CCTGCTAAACATCTCAGATTTTG No data
Right 1010518720 6:76806631-76806653 CTTCCAGTCTCTTTTCTTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1010518718 Original CRISPR CAAAATCTGAGATGTTTAGC AGG (reversed) Intergenic
No off target data available for this crispr