ID: 1010524654

View in Genome Browser
Species Human (GRCh38)
Location 6:76885831-76885853
Sequence CTGCTACTCAGTTGTCACCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1010524654_1010524655 -4 Left 1010524654 6:76885831-76885853 CCTGGGTGACAACTGAGTAGCAG No data
Right 1010524655 6:76885850-76885872 GCAGAACTAAACGAGTCCTGTGG No data
1010524654_1010524659 29 Left 1010524654 6:76885831-76885853 CCTGGGTGACAACTGAGTAGCAG No data
Right 1010524659 6:76885883-76885905 TCCTCTCCTGCTTAAGTAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1010524654 Original CRISPR CTGCTACTCAGTTGTCACCC AGG (reversed) Intergenic
No off target data available for this crispr