ID: 1010535108

View in Genome Browser
Species Human (GRCh38)
Location 6:77017190-77017212
Sequence TCCCAAAATATTCACAGAAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1010535108_1010535112 13 Left 1010535108 6:77017190-77017212 CCTCTTCTGTGAATATTTTGGGA No data
Right 1010535112 6:77017226-77017248 GCAGAGGAAACAGCAAGAGAAGG No data
1010535108_1010535111 -3 Left 1010535108 6:77017190-77017212 CCTCTTCTGTGAATATTTTGGGA No data
Right 1010535111 6:77017210-77017232 GGATAGCACGAGGTAGGCAGAGG No data
1010535108_1010535114 15 Left 1010535108 6:77017190-77017212 CCTCTTCTGTGAATATTTTGGGA No data
Right 1010535114 6:77017228-77017250 AGAGGAAACAGCAAGAGAAGGGG No data
1010535108_1010535110 -9 Left 1010535108 6:77017190-77017212 CCTCTTCTGTGAATATTTTGGGA No data
Right 1010535110 6:77017204-77017226 ATTTTGGGATAGCACGAGGTAGG No data
1010535108_1010535113 14 Left 1010535108 6:77017190-77017212 CCTCTTCTGTGAATATTTTGGGA No data
Right 1010535113 6:77017227-77017249 CAGAGGAAACAGCAAGAGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1010535108 Original CRISPR TCCCAAAATATTCACAGAAG AGG (reversed) Intergenic
No off target data available for this crispr