ID: 1010535113

View in Genome Browser
Species Human (GRCh38)
Location 6:77017227-77017249
Sequence CAGAGGAAACAGCAAGAGAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1010535108_1010535113 14 Left 1010535108 6:77017190-77017212 CCTCTTCTGTGAATATTTTGGGA No data
Right 1010535113 6:77017227-77017249 CAGAGGAAACAGCAAGAGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1010535113 Original CRISPR CAGAGGAAACAGCAAGAGAA GGG Intergenic
No off target data available for this crispr