ID: 1010535295

View in Genome Browser
Species Human (GRCh38)
Location 6:77020469-77020491
Sequence GGGGAGTTGAAGAGTTTAAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1010535290_1010535295 1 Left 1010535290 6:77020445-77020467 CCTCACTTGTAAGTTTAAGAGGG No data
Right 1010535295 6:77020469-77020491 GGGGAGTTGAAGAGTTTAAGAGG No data
1010535288_1010535295 13 Left 1010535288 6:77020433-77020455 CCTTAACAGTAACCTCACTTGTA No data
Right 1010535295 6:77020469-77020491 GGGGAGTTGAAGAGTTTAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1010535295 Original CRISPR GGGGAGTTGAAGAGTTTAAG AGG Intergenic
No off target data available for this crispr