ID: 1010550103

View in Genome Browser
Species Human (GRCh38)
Location 6:77211397-77211419
Sequence TTTATATAGACCCCAAACCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1010550100_1010550103 8 Left 1010550100 6:77211366-77211388 CCTACGGCAGGAGGTAATAACTA No data
Right 1010550103 6:77211397-77211419 TTTATATAGACCCCAAACCCTGG No data
1010550096_1010550103 19 Left 1010550096 6:77211355-77211377 CCTATGCCCAGCCTACGGCAGGA No data
Right 1010550103 6:77211397-77211419 TTTATATAGACCCCAAACCCTGG No data
1010550098_1010550103 13 Left 1010550098 6:77211361-77211383 CCCAGCCTACGGCAGGAGGTAAT No data
Right 1010550103 6:77211397-77211419 TTTATATAGACCCCAAACCCTGG No data
1010550099_1010550103 12 Left 1010550099 6:77211362-77211384 CCAGCCTACGGCAGGAGGTAATA No data
Right 1010550103 6:77211397-77211419 TTTATATAGACCCCAAACCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1010550103 Original CRISPR TTTATATAGACCCCAAACCC TGG Intergenic
No off target data available for this crispr