ID: 1010551741

View in Genome Browser
Species Human (GRCh38)
Location 6:77231782-77231804
Sequence TGTGGCAATCGGCTGAAACT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1010551737_1010551741 0 Left 1010551737 6:77231759-77231781 CCAGTGTATCTGGAGAAATAAGC No data
Right 1010551741 6:77231782-77231804 TGTGGCAATCGGCTGAAACTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1010551741 Original CRISPR TGTGGCAATCGGCTGAAACT GGG Intergenic