ID: 1010551791

View in Genome Browser
Species Human (GRCh38)
Location 6:77232322-77232344
Sequence TTCAGTTGATGCAGATCAAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1010551791_1010551793 -1 Left 1010551791 6:77232322-77232344 CCATTTGATCTGCATCAACTGAA No data
Right 1010551793 6:77232344-77232366 AATAGTTCTTTGGTAACATTTGG No data
1010551791_1010551796 5 Left 1010551791 6:77232322-77232344 CCATTTGATCTGCATCAACTGAA No data
Right 1010551796 6:77232350-77232372 TCTTTGGTAACATTTGGGGAAGG No data
1010551791_1010551798 7 Left 1010551791 6:77232322-77232344 CCATTTGATCTGCATCAACTGAA No data
Right 1010551798 6:77232352-77232374 TTTGGTAACATTTGGGGAAGGGG No data
1010551791_1010551794 0 Left 1010551791 6:77232322-77232344 CCATTTGATCTGCATCAACTGAA No data
Right 1010551794 6:77232345-77232367 ATAGTTCTTTGGTAACATTTGGG No data
1010551791_1010551797 6 Left 1010551791 6:77232322-77232344 CCATTTGATCTGCATCAACTGAA No data
Right 1010551797 6:77232351-77232373 CTTTGGTAACATTTGGGGAAGGG No data
1010551791_1010551795 1 Left 1010551791 6:77232322-77232344 CCATTTGATCTGCATCAACTGAA No data
Right 1010551795 6:77232346-77232368 TAGTTCTTTGGTAACATTTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1010551791 Original CRISPR TTCAGTTGATGCAGATCAAA TGG (reversed) Intergenic
No off target data available for this crispr