ID: 1010551794

View in Genome Browser
Species Human (GRCh38)
Location 6:77232345-77232367
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1010551791_1010551794 0 Left 1010551791 6:77232322-77232344 CCATTTGATCTGCATCAACTGAA No data
Right 1010551794 6:77232345-77232367 ATAGTTCTTTGGTAACATTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1010551794 Original CRISPR ATAGTTCTTTGGTAACATTT GGG Intergenic
No off target data available for this crispr