ID: 1010562631

View in Genome Browser
Species Human (GRCh38)
Location 6:77369243-77369265
Sequence TAACACAGGATTGCTGGGAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1010562631_1010562637 -6 Left 1010562631 6:77369243-77369265 CCCTTCCCAGCAATCCTGTGTTA No data
Right 1010562637 6:77369260-77369282 GTGTTACTCTATGGAGAGTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1010562631 Original CRISPR TAACACAGGATTGCTGGGAA GGG (reversed) Intergenic
No off target data available for this crispr