ID: 1010567218

View in Genome Browser
Species Human (GRCh38)
Location 6:77431024-77431046
Sequence CTACCACCTCTAGTATCCCT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1010567217_1010567218 25 Left 1010567217 6:77430976-77430998 CCTGCTGCTTTGTTTCTTGTGTG No data
Right 1010567218 6:77431024-77431046 CTACCACCTCTAGTATCCCTAGG No data
1010567215_1010567218 27 Left 1010567215 6:77430974-77430996 CCCCTGCTGCTTTGTTTCTTGTG No data
Right 1010567218 6:77431024-77431046 CTACCACCTCTAGTATCCCTAGG No data
1010567216_1010567218 26 Left 1010567216 6:77430975-77430997 CCCTGCTGCTTTGTTTCTTGTGT No data
Right 1010567218 6:77431024-77431046 CTACCACCTCTAGTATCCCTAGG No data
1010567214_1010567218 30 Left 1010567214 6:77430971-77430993 CCTCCCCTGCTGCTTTGTTTCTT No data
Right 1010567218 6:77431024-77431046 CTACCACCTCTAGTATCCCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1010567218 Original CRISPR CTACCACCTCTAGTATCCCT AGG Intergenic
No off target data available for this crispr