ID: 1010569564

View in Genome Browser
Species Human (GRCh38)
Location 6:77461950-77461972
Sequence CCTTTGGGATTGGCTGCCGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1010569555_1010569564 10 Left 1010569555 6:77461917-77461939 CCTTCCATTATCAATTTTTAAAA No data
Right 1010569564 6:77461950-77461972 CCTTTGGGATTGGCTGCCGCAGG No data
1010569553_1010569564 30 Left 1010569553 6:77461897-77461919 CCAAAGCAGGGCAGGGATTCCCT No data
Right 1010569564 6:77461950-77461972 CCTTTGGGATTGGCTGCCGCAGG No data
1010569556_1010569564 6 Left 1010569556 6:77461921-77461943 CCATTATCAATTTTTAAAAGTTG No data
Right 1010569564 6:77461950-77461972 CCTTTGGGATTGGCTGCCGCAGG No data
1010569554_1010569564 11 Left 1010569554 6:77461916-77461938 CCCTTCCATTATCAATTTTTAAA No data
Right 1010569564 6:77461950-77461972 CCTTTGGGATTGGCTGCCGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1010569564 Original CRISPR CCTTTGGGATTGGCTGCCGC AGG Intergenic
No off target data available for this crispr