ID: 1010569982

View in Genome Browser
Species Human (GRCh38)
Location 6:77464170-77464192
Sequence GAGCCATGCCACTGGGTGCG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1010569965_1010569982 21 Left 1010569965 6:77464126-77464148 CCGCGCCGCCGCCACCGCCACCC No data
Right 1010569982 6:77464170-77464192 GAGCCATGCCACTGGGTGCGCGG No data
1010569974_1010569982 1 Left 1010569974 6:77464146-77464168 CCCTGGTCCCACGGGAGCCACTC No data
Right 1010569982 6:77464170-77464192 GAGCCATGCCACTGGGTGCGCGG No data
1010569968_1010569982 13 Left 1010569968 6:77464134-77464156 CCGCCACCGCCACCCTGGTCCCA No data
Right 1010569982 6:77464170-77464192 GAGCCATGCCACTGGGTGCGCGG No data
1010569973_1010569982 4 Left 1010569973 6:77464143-77464165 CCACCCTGGTCCCACGGGAGCCA No data
Right 1010569982 6:77464170-77464192 GAGCCATGCCACTGGGTGCGCGG No data
1010569972_1010569982 7 Left 1010569972 6:77464140-77464162 CCGCCACCCTGGTCCCACGGGAG No data
Right 1010569982 6:77464170-77464192 GAGCCATGCCACTGGGTGCGCGG No data
1010569978_1010569982 -7 Left 1010569978 6:77464154-77464176 CCACGGGAGCCACTCGGAGCCAT No data
Right 1010569982 6:77464170-77464192 GAGCCATGCCACTGGGTGCGCGG No data
1010569969_1010569982 10 Left 1010569969 6:77464137-77464159 CCACCGCCACCCTGGTCCCACGG No data
Right 1010569982 6:77464170-77464192 GAGCCATGCCACTGGGTGCGCGG No data
1010569975_1010569982 0 Left 1010569975 6:77464147-77464169 CCTGGTCCCACGGGAGCCACTCG No data
Right 1010569982 6:77464170-77464192 GAGCCATGCCACTGGGTGCGCGG No data
1010569967_1010569982 16 Left 1010569967 6:77464131-77464153 CCGCCGCCACCGCCACCCTGGTC No data
Right 1010569982 6:77464170-77464192 GAGCCATGCCACTGGGTGCGCGG No data
1010569977_1010569982 -6 Left 1010569977 6:77464153-77464175 CCCACGGGAGCCACTCGGAGCCA No data
Right 1010569982 6:77464170-77464192 GAGCCATGCCACTGGGTGCGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1010569982 Original CRISPR GAGCCATGCCACTGGGTGCG CGG Intergenic