ID: 1010578230

View in Genome Browser
Species Human (GRCh38)
Location 6:77560839-77560861
Sequence TTGCTTCAGTGGCAAGTTGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1010578230_1010578235 10 Left 1010578230 6:77560839-77560861 CCATCAACTTGCCACTGAAGCAA No data
Right 1010578235 6:77560872-77560894 TAGAAACTGCCTGAAATAAAGGG No data
1010578230_1010578234 9 Left 1010578230 6:77560839-77560861 CCATCAACTTGCCACTGAAGCAA No data
Right 1010578234 6:77560871-77560893 ATAGAAACTGCCTGAAATAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1010578230 Original CRISPR TTGCTTCAGTGGCAAGTTGA TGG (reversed) Intergenic
No off target data available for this crispr